METHODS FOR THE PREPARATION OF PROTEINS DERIVED FROM PLANTS

专利摘要:
method of preparing plant-derived proteins. the present invention relates to methods of preparing plant-derived proteins or superstructure proteins, which are provided. the method may comprise obtaining a plant, or plant material comprising proteins located in the apoplast, or superstructure proteins, producing a fraction of protoplasts / spheroplasts and a fraction of apoplasts from the plant or plant matter, and recovery of the apoplast fraction . the apoplast fraction comprises proteins derived from the plant or proteins from the superstructure. alternatively, proteins, or superstructure proteins. alternatively, proteins, or superstructure proteins, can be obtained from the plant or plant matter comprising proteins derived from the plant or superstructure proteins, by digesting the plant matter using an enzymatic composition that degrades the cell wall to produce a digested fraction. the digested fraction is filtered to produce a filtered fraction, and proteins derived from the plant or superstructure proteins are recovered from the filtered fraction.
公开号:BR112012006414B1
申请号:R112012006414-2
申请日:2010-09-21
公开日:2020-09-15
发明作者:Manon Couture；Dany Paquet；Michele Dargis；Marc-Andre D'Aoust；Louis-Philippe Vezina
申请人:Medicago Inc；
IPC主号:

专利说明:

FIELD OF INVENTION
[0001] The present invention relates to methods of preparing plant-derived proteins. More specifically, the present invention provides methods for obtaining proteins, including protein superstructures, from plants and plant tissues. BACKGROUND OF THE INVENTION
[0002] Current recombinant expression strategies in host cells, such as E. coli, insect cell culture, and mammalian cell culture express and secrete proteins at a high level in culture media. Using these systems of high levels of expression, appropriate protein folding and post-translational protein modification, it is possible. In addition, the purification of the expressed protein is simplified since intracellular proteins can be readily secreted from other components (DNA, vesicle, membranes, pigments and the like). In vegetable or yeast expression systems, the cell wall prevents the secretion of the protein expressed in the culture media.
[0003] Different approaches are widely used in the science of generating cell extracts. Mechanical approaches to disrupt the cell wall and release its content are usually non-selective for a certain class of proteins or cellular components. Directing the expression of a protein of interest in cell culture media, allowing the removal of intracellular contaminants by centrifugation or filtration, allows simple and rapid enrichment of the protein of interest. It may also be desirable to separate a protein or superstructure protein of interest, including protein rosettes, nanoparticles, large protein complexes, antibodies or virus-like particles (VLPs), and the like, from some, or all, proteins, DNA, fragments membrane, vesicles, pigments, carbohydrates, etc. present in the plant or plant material before the superstructure proteins of interest are used in the vaccine formulation.
[0004] Immunoglobulins (IgGs) are complex heteromultimer proteins with characteristic affinity for specific antigenic counterparts of various natures. Today, the regular isolation of IgG-producing cell lines, and the advent of technologies for evolution and molecular engineering aimed at IgG have profoundly impacted their evolution as biotherapeutics and in the life science market in general. Therapeutic monoclonal IgG (monoclonal antibodies, mAbs) dominate the current market for new anti-inflammatory and anticancer drugs and hundreds of new candidates are currently under clinical research and development for improved or new applications. The annual market demand for mAbs ranges from a few grams (diagnosis), a few kilograms (antitoxin) to up to one or more hundred kilograms (biodefense, anticancer, anti-infective, anti-inflammatory). Methods for producing modified glycoproteins from plants are described in WO 2008/151440 (which is incorporated in this application by reference).
[0005] A method for extracting protein from the intercellular space of plants, comprising a vacuum and centrifugation process to provide an interstitial fluid extract comprising the protein of interest is described in PCT Publication WO 00/09725 (by Turpen et al. ). This approach is suitable for small proteins (50 kDa or smaller) that pass through the microfiber network under vacuum and centrifugation, but it is not suitable for larger proteins, proteins with superstructure, protein rosettes, nanoparticles, large protein complexes, such as antibodies or VLPs.
[0006] McCormick et al., 1999 (Proc Natl Acad Sei USA 96: 703- 708) disclose the use of a rice amylase signal peptide fused to the Fv single chain (scFv) epitope to target the expressed protein to the extracellular compartment , followed by vacuum infiltration of leaf and stem tissue to recover scFv polypeptides. Moehnke et al., 2008 (Biotechnol Lett 30: 1259-1264) describe the use of McCormick's vacuum infiltration method to obtain a recombinant vegetable allergen from tobacco using an apoplastic extraction. PCT Publication WO 2003/025124 (by Zhang et al) discloses the expression of scFv immunoglobulins in plants, targeting the apoplastic space using murine signal sequences.
[0007] Virus-like particles (VLPs) can be used to prepare vaccines for influenza. Superstructures, such as VLPs, mimic the structure of the viral capsid, but do not have a genome, and therefore cannot replicate or provide means for a secondary infection. VLPs offer an improved alternative to isolated (soluble) recombinant antigens to stimulate a strong immune response. VLPs are assembled according to the expression of specific viral proteins and have an outer surface that looks like that of your cognate virus, but, unlike the true viral particle, it does not incorporate genetic material. The presentation of antigens in a particulate and multivalent structure similar to that of the native virus achieves an increased stimulation of the immune response with balanced humoral and cellular components. It is believed that such improvement over stimulation by isolated antigens is particularly true for enveloped viruses since enveloped VLPs present surface antigens in their state bound to the natural membrane (Grgacic and Anderson, 2006, Methods 40, 60-65). In addition, Influenza VLPs, with their nanoparticle organization, have been shown to be better candidates for vaccine compared to recombinant hemagglutinin HA (i.e., monomeric HA, or HA organized on rosettes; cluster of 3-8 HA trimers) , and are able to activate both the humoral and cellular immune responses. (Bright, R.A., e. Al .. 2007, Vaccine25, 3871-3878).
[0008] Influenza VLPs were obtained in mammalian cells cultured from the coexpression of 10 influenza proteins (Mena et al., 1996, J. Virol.70, 5016-5024). Several viral proteins are expendable for the production of VLPs, and influenza VLPs in vaccine development programs were produced from the coexpression of the 2 main antigenic envelope proteins (HA and NA) with M1 or from the coexpression of HA and M1 only (Kang et al., 2009, Virus Res.143, 140-146). Chen et al. (2007, J. Virol.81, 7111-7123) showed that HA alone is able to direct the formation and sprouting of VLP and the coexpression of M1 could be omitted in their system. However, since binding of HA to siallylated glycoproteins was found on the surface of the mammalian cells that produce the VLPs, a viral sialidatase was coexpressed to allow the release of VLPs from the producer cell after budding.
[0009] PCT Publication WO 2006/119516 (by Williamson and Rybicki) reveals the full-length expression of Influenza A / Vietnam / 1194/2004 HA and the optimized for human H5 codon truncated in plants. The truncated construct does not have the membrane anchoring domain. The greatest accumulation of HA protein was obtained with constructs that target ER. Constructs without a membrane targeting domain did not produce detectable HA. The production of VLPs has not been reported.
[00010] HA production of influenza from VLPs comprising a lipid envelope was previously described by the inventors in WO 2009/009876 and WO 2009/076778 (by D'Aoust et al .; both of which are incorporated in this application by reference) . For enveloped viruses, it may be advantageous for a lipid or membrane layer to be conserved by the virus. The composition of the lipid can vary with the system (for example, an enveloped virus produced from a plant would include plant lipids or phytosterols in the envelope), and can contribute to an improved immune response.
[00011] The assembly of VLPs enveloped in transgenic tobacco that expresses HBV surface antigen (HBsAg) has been described by Mason et al. (1992, Proc. Natl. Acad. Sci. USA 89, 11745-11749). HBV from VLPs produced from plants has been shown to induce potent B and T cell immune responses in mice when administered parenterally (Huang et al., 2005, Vaccine23, 1851-1858) but oral immunization through feeding-only studies induced a modest immune response (Smith et al., 2003, Vaccine21, 4011-4021). Greco (2007, Vaccine25, 8228-8240) showed that epitopes of the human immunodeficiency virus (HIV) in fusion with HBsAg accumulated as VLP when expressed in transgenic tobacco and Arabidopsis, creating a bivalent VLP vaccine.
[00012] Expression of viral capsid protein (NVCP) in tobacco and transgenic potatoes resulted in the assembly of non-enveloped VLPs (Mason et al., 1996, Proc. Natl. Acad. Sci. USA 93, 5335- 5340). NVCP VLPs were produced in N. benthamiana agro-infiltrated leaves (Huang et al. 2009, Biotechnol. Bioeng. 103, 706-714) and their immunogenicity after oral administration was demonstrated in mice (Santi et al., 2008, Vaccine26, 1846 - 1854). Administration of 2 or 3 doses of raw potatoes containing 215-751 pg of NVCP in the form of VLPs to healthy adult volunteers resulted in the development of an immune response in and 95% of the immunized volunteers (Tacket et al. 2000, J. Infect. Dis.182, 302-305). Non-enveloped VLPs were also obtained from the expression of the HBV core antigen (HBcAg; Huang et al., 2009, Biotechnol. Bioeng.103, 706-714), and the main human papillomavirus (HPV) L1 capsid protein ( Varsani et al., 2003, Arch. Virol. 148, 1771-1786).
[00013] A simpler protein, or suprastructure protein production system, for example, one that depends on the expression of only one or a few proteins is desirable. The production of proteins, or protein superstructures, for example, but not limited to protein rosettes, nanoparticles, large protein complexes, such as antibodies or VLPs, in plant systems is advantageous, as plants can be grown in a greenhouse or field , and do not require aseptic tissue culture and manipulation methods.
[00014] Methods of preparing proteins, or proteins, or protein superstructures, which are substantially free, or easily separated from plant proteins, while still retaining the characteristics and structure of the protein are desired. SUMMARY OF THE INVENTION
[00015] The present invention relates to methods of preparing plant-derived proteins. More specifically, the present invention provides methods for obtaining proteins, including plant protein superstructures and plant tissues.
[00016] It is an object of the invention to provide an improved method of preparing plant-derived proteins.
[00017] The present invention provides a method (A) for preparing plant-derived proteins, or proteins, or protein superstructures, comprising obtaining a plant or plant material comprising plant-derived proteins, or protein superstructures, located in the apoplast ; production of a protoplast and a fraction of a plasmid, the fraction of a plasmid comprising plant-derived proteins, or protein superstructures; and recovery of the apoplast fraction. The method may further comprise a step of purifying plant-derived proteins, or proteins, or protein superstructures, from the apoplast fraction. Plant-derived proteins, or proteins, or protein superstructures, can be chimeric plant-derived proteins, or superstructure proteins. Plant-derived proteins, or proteins, or protein superstructures, can be heterologous to the plant. Plant-derived proteins, or proteins, or protein superstructures, can include a protein rosette, a protein complex, a proteasome, a metabolon, a transcription complex, a recombination complex, a photosynthetic complex, a membrane transport complex, a nuclear pore complex, a protein nanoparticle, a glycoprotein, an antibody, a polyclonal antibody, a monoclonal antibody, a single chain monoclonal antibody, a virus-like particle, a viral envelope protein, a viral structural protein, a protein of viral capsid, and a viral envelope protein, a chimeric protein, a chimeric protein complex, a chimeric protein nanoparticle, a chimeric glycoprotein, a chimeric antibody, a chimeric monoclonal antibody, a chimeric monoclonal antibody, a chimeric hemagglutinin, a chimeric hemagglutinin, a chimeric hemagglutinin viral envelope protein, a viral structural protein, a viral capsid protein, and a protein of viral wrap. The plant-derived monoclonal antibody may comprise a human murine chimeric monoclonal antibody, for example, but not limited to C2B8. Plant-derived VLPs can comprise influenza hemagglutinin.
[00018] The apoplast and protoplast fractions can be produced by treating vegetable or vegetable matter with an enzymatic composition. The enzyme composition can comprise one or more of a pectinase, one or more of a cellulase, or one or more of a pectinase and one or more of a cellulase. In addition, if desired, the enzyme composition does not include a lipase or protease, or the composition does not include an added lipase or protease.
[00019] The plant or plant material can be obtained by growing, collecting or growing and collecting the plant. Plant matter may comprise part or all of the plant, one or more of a plant cell, leaves, stems, roots or cultivated plant cells.
[00020] The present invention provides a method of preparing plant-derived proteins, or proteins, or protein superstructures, as described above (Method A), in which a nucleic acid encoding proteins, or protein superstructures, is introduced into the plant in a transient way. Alternatively, the nucleic acid is stably integrated into the plant's genome.
[00021] The present invention provides a method of preparing plant-derived proteins, or protein superstructures, as described above (Method A) further comprising a step of purifying plant-derived proteins, or protein superstructures, from the apoplast fraction. . The purification step may comprise filtration of the apoplast fraction using depth filtration to produce a clarified extract, followed by chromatography of the clarified extract using a cation exchange resin, affinity chromatography, size exclusion chromatography, or a combination thereof .
[00022] Without intending to be limited by theory, proteins obtained from the apoplast are more homogeneous, since the intermediate forms of post-translationally modified proteins, or proteins comprising other types of processing that occur in several intracellular compartments, for example , mitochondria, chloroplast and other organelles are not coextracted. A higher degree of homogeneity of a recombinant protein typically results in a higher quality of a preparation comprising the protein, and can result in a product with beneficial properties including greater potency, longer half-life, or better immunogenic capacity. For example, blood proteins containing high glycosylation of mannose are eliminated into the bloodstream more quickly than proteins comprising complex glycosylation. A glycosylated protein produced in the apoplastic fraction exhibits more complex type glycosylation. Therefore, a protein derived from the apoplast prepared using the methods described in this application, involving digestion of the cell wall, exhibits, for example, a better half-life in the circulation.
[00023] Plant-derived proteins, or protein superstructures, can include protein rosettes, protein complexes, protein nanoparticles, antibodies, monoclonal antibodies, VLPs. VLPs can comprise one or more influenza HA polypeptides. The superstructure proteins can be a chimeric superstructure proteins, for example, the monoclonal antibody can be a chimeric monoclonal antibody, or influenza HA polypeptide, it can be a chimeric HA polypeptide. If the superstructure proteins are a VLP, then the plant-derived VLP may further comprise hemagglutinating activity. The plant or plant material can be obtained by growing, collecting or growing and collecting the plant. Plant matter may comprise part or all of the plant, or one or more of a plant cell, leaves, stems, roots or cultivated cells.
[00024] The present invention also provides a method (B) of preparing plant-derived proteins, or protein superstructures, comprising obtaining a plant or plant material comprising plant-derived proteins, or protein superstructures, digesting plant matter using a composition enzymatic degradation of the cell wall to produce a digested fraction, and filtration of the digested fraction to produce a filtered fraction and recovery of plant-derived proteins, or protein superstructures, from the filtered fraction.
[00025] The enzyme composition can comprise one or more of a pectinase, one or more of a cellulase, or one or more of a pectinase and one or more of a cellulase. In addition, if desired, the enzyme composition does not include a lipase or protease, or the composition does not include an added lipase or protease. The plant-derived superstructure proteins can be a plant-derived chimeric superstructure proteins. Plant-derived superstructure proteins can include a protein rosette, a protein complex, a proteasome, a metabolon, a transcription complex, a recombination complex, a photosynthetic complex, a membrane transport complex, a nuclear pore complex, a protein nanoparticle, a glycoprotein, an antibody, a polyclonal antibody, a monoclonal antibody, a single chain monoclonal antibody, a virus-like particle, a viral envelope protein, a viral structural protein, a viral capsid protein, and a viral envelope protein, a chimeric protein, a chimeric protein complex, a chimeric protein nanoparticle, a chimeric glycoprotein, a chimeric antibody, a chimeric monoclonal antibody, a chimeric monoclonal antibody, a chimeric hemagglutinin, a viral envelope protein, a viral structural protein, a viral capsid protein, and a viral envelope protein. The plant-derived monoclonal antibody may comprise a human murine chimeric monoclonal antibody, for example, but not limited to C2B8. Plant-derived VLPs can comprise influenza hemagglutinin.
[00026] The present invention provides a method of preparing plant-derived proteins, or protein superstructures, as described above (Method B), in which a nucleic acid encoding proteins, or protein superstructures, is introduced into the plant in a manner transient. Alternatively, the nucleic acid is stably integrated into the plant's genome.
[00027] The present invention provides a method of preparing plant-derived VLPs as described above (Method B) further comprising a step of separating proteins, or protein superstructures, in the filtered fraction of cell fragment and insoluble materials. The separation step can be performed by centrifugation, by depth filtration, or by vigorous centrifugation and depth filtration to produce a clarified fraction. Plant-derived proteins, or protein superstructures, can be further purified by chromatography, for example, the clarified extract can be purified using a cation exchange resin, an affinity resin, size exclusion chromatography, or a combination thereof.
[00028] Plant-derived proteins, or protein superstructures, can include protein rosettes, protein complexes, protein nanoparticles, glycoproteins, antibodies, monoclonal antibodies, VLPs. VLPs can comprise one or more influenza HA polypeptides. The superstructure proteins can be a chimeric superstructure proteins, for example, the monoclonal antibody can be a chimeric monoclonal antibody, or the influenza HA polypeptide, can be a chimeric HA polypeptide. If the superstructure proteins are a VLP, then the plant-derived VLP may further comprise hemagglutinating activity.
[00029] Without claiming to be limited by theory, plant-produced VLPs, comprising plant-derived lipids, can induce a stronger immune reaction than VLPs produced in other manufacturing systems and that immune reaction induced by these plant-produced VLPs is more strong compared to the immune reaction induced by whole live or attenuated virus vaccines.
[00030] The composition of a protein extract obtained from a host cell is complex and typically comprises intercellular and intracellular components together with the protein or superstructure of interest that must be isolated. The preparation of an apoplastic fraction, followed by a step to segregate proteins and intracellular components is advantageous since the protein or the superstructure of interest can be enriched and increase efficiency within a manufacturing process. A simpler process, comprising shorter efficient steps, can result in significant yield increases, and cost savings. It has also been found that the cell wall digestion process using enzymes that degrade the cell wall increases the yield of suprastructure proteins even if the protoplasts do not remain intact during the extraction procedure. Without claiming to be limited by theory, the cell wall digestion step can detach the polymeric components of the cell wall and assist in the release of proteins, or protein superstructures, otherwise associated within the cell wall. This protocol can also minimize contamination of proteins, or protein superstructures, within intracellular components.
[00031] Methods for digesting the plant cell wall are known, and enzyme cocktail mixtures that digest cell walls can vary. The present invention is not limited by the cell wall digestion method used.
[00032] The methods described in this application result in less disturbance, and contamination of a plant-derived superstructure protein extract compared to methods for preparing plant-derived superstructure proteins implying homogenization, mixing or grinding. The methods described in this application provide a fraction of apoplast from plant tissue and these can maintain the integrity of protoplasts and their components. The method as described in this application is effective in purifying proteins, or protein superstructures, even if the protoplasts, or portion of the protoplasts, lose their integrity and are no longer intact.
[00033] These methods provide superior protein yield, or protein superstructures, compared to methods of extracting superstructure proteins involving standard tissue disruption techniques, for example, homogenization, mixing or milling. The higher yield may be due, in part, to a reduction in shredding forces that disrupt the structural integrity of proteins, or protein superstructures, and in the case of VLPs, the lipid envelope. The preparation of proteins, or protein superstructures, from an apoplastic fraction can be advantageous, since apoplastic fractions are significantly reduced, or free of cytoplasmic proteins. Therefore, the separation of the superstructure proteins from other proteins and matter, including monomers, dimers, trimers or fragments of the superstructure proteins, in the apoplastic fraction is easily accomplished. However, an increase in protein yield, or protein superstructures, can also be obtained using the methods described in this application, even if the protoplast preparation, or portion of the protoplast preparation, is not intact.
[00034] Glycoproteins, including protein glycosuprostructures, for example, monoclonal antibodies, which are secreted in the apoplast comprise a higher percentage of N-glycans that have completed their maturation and comprise terminal N-acetiglucosamine residues or galactose (complex N-glycans), in comparison with extraction methods that do not digest the cell wall, for example, plants extracted in a blender. Protein glycosuprostructures, for example, monoclonal antibodies, comprising N complex glycans, have been found to exhibit the beneficial property of increased half-life in the bloodstream compared to monoclonal antibodies comprising terminal mannose residues (immature N glycans).
[00035] Using enzymatic digestion of the cell wall, it may be possible to release a cluster of apoplastic antibodies that comprise N-glycans that have completed their maturation. This extraction method can allow the recovery of an enriched population, or homogeneous population of glycosylated antibodies that carry complex N-glycans, separating the immature forms of the glycosylated antibodies in the protoplast fraction. If the grouping of antibodies that carry immature N-glycans is desired, the protoplast fraction can be conserved and the antibodies purified from the protoplast fraction.
[00036] The VLPs of the present invention are also characterized by having a greater hemagglutinating activity than those obtained using standard tissue rupture techniques. This improved haemagglutinating activity may result from a higher yield of intact VLPs (less free HA monomers or trimers in the solution), a higher yield of intact VLPs with intact lipid envelopes, or a combination of them.
[00037] Vaccines produced using VLPs provide the advantage, compared to vaccines produced with whole viruses, of being non-infectious. Therefore, biological containment is not a problem and is not necessary for production. The VLPs produced at the plant provide an additional advantage by allowing the expression system to be grown in a greenhouse or field, thus being significantly more economical and suitable for large scale.
[00038] Additionally, plants do not comprise enzymes involved in the synthesis and addition of sialic acid residues add to proteins. VLPs can be produced in the absence of neuraminidase (NA), and there is no need to coexpress NA, or treat the producing cells or extract with sialidase (neuraminidase), to ensure the production of VLP in plants
[00039] This summary of the invention does not necessarily describe all features of the invention. BRIEF DESCRIPTION OF THE DRAWINGS
[00040] These and other characteristics of the invention will be more evident from the following description in which reference is made to the attached drawings in which:
[00041] Figure 1 shows a schematic representation of the expression cassette based on CPMVHT (construct 685) for the expression of hemagglutinin H5 A / Indonesia / 5/05.
[00042] Figure 2 shows A) the nucleic acid sequence (SEQ ID NO. 1) of a portion of the construct for expression of H5 / lndo (construct number 685) from Pad (upstream of the 35S promoter) to Ascl (immediately downstream of the NOS terminator). The H5 A / Indonesia / 5/2005 coding sequence is underlined. Figure 2B shows the amino acid sequence (SEQ ID NO. 2) of hemagglutinin H5 A / Indonesia / 5/05 encoded by construct number 685.
[00043] Figure 3 shows the characterization of structures containing hemagglutinin (HA) by size exclusion chromatography (SEC). After centrifuging the digested plant extract, the precipitate was resuspended and fractionated by SEC. Figure 3A shows the total soluble protein content per fraction (solid triangles;% of the maximum, Y axis on the left side; determined using the Bradford method). The hemagglutinating activity of the collected fractions (solid bars; Y axis on the right side) is also shown. Figure 3B shows the SDS-PAGE analysis of fractions eluted from SEC. The fractions were precipitated in acetone and resuspended in 1/40 volume of sample loading reducing buffer before analysis. The gel was marked with 0.1% Coomassie R-250 solution. The purified VLPs were run as a control. The band corresponding to the HA0 monomer is indicated by an arrow. MW - Molecular weight standards (kDa); C - purified VLPs (control); columns 7 to 10 and 14 to 16 correspond to the number of fractions eluted from the SEC analysis, shown in Figure 3A.
[00044] Figure 4 shows a comparison of protein profiles obtained after enzymatic digestion and mechanical homogenization using a Comitrol ™ homogenizer. The samples were treated in denaturing sample loading buffer and the proteins were separated by SDS-PAGE analysis of the elution fractions. The gels were marked with 0.1% Coomassie R-250 solution. MW - Molecular weight standards (kDa); column 1 - 25 pl enzymatic mixture; column 2 - 25 pl enzymatic digestion of plant tissue and column 3 - 5 pl extract obtained with the Comitrol homogenizer.
[00045] Figure 5 shows the nucleic acid sequence (SEQ ID NO: 9) of an HA expression cassette comprising the alfalfa plastocyanin 5 'UTR promoter, the H5 hemagglutinin coding sequence from A / lndonesia / 5/2005 (Construct # 660), 3 'RTU sequences and alfalfa plastocyanin terminator.
[00046] Figure 6 shows that the capture of HA-VLP in the cation exchange resin directly forms the separation of HA-VLP in the apoplastic fraction. The samples were treated in non-reducing, denaturing sample loading buffer and the proteins were separated by SDS-PAGE. The gels were marked with 0.1% Coomassie R-250 solution. Column 1: apoplastic fraction after centrifugation, Column 2-3: apoplastic fraction after successive microfiltration; Column 4: Cation exchange charge; Column 5: Eluted from the fraction of the cation exchange. Column 6; elution of cation exchange, concentrated 10X; Column 7: Molecular weight standards (kDa).
[00047] Figure 7 shows the profile of the Nanoparticle Location (NTA) analysis of VLP H5 / lndo (Figure 7A) and VLP H1 / Cal (Figure 7B) after clarification without the addition of NaCI to the digestion buffer and VLP H1 / Cal (Figure 7C) with this addition. The NTA experiments were carried out with NanoSight LM20 (NanoSight, Amesbury, UK). The instrument is equipped with a blue laser beam (405 nm), a sample chamber and a Viton o-ring fluoroelastomer. The videos were recorded at room temperature and analyzed using the NTA 2.0 program. The samples were recorded for 60 sec. The shutter and the gain were manually chosen so that optimal particle resolution was obtained.
[00048] Figure 8 shows a Western blot of the VLP H3 / Brisbane extract generated by enzymatic digestion using different buffers. Column 1) Standard recombinant pure HA (5 pg, from Immune Technology Corp. IT-003-0042p) Columns 2 to 5 contain 7 pl of the centrifuged enzyme extract performed in the following buffers: Column 2) 600mM Mannitol + 125 mM citrate + NaPO4 75 mM + 25 mM EDTA + 0.04% bisulfite pH6.2, Column 3) 600mM Mannitol + 125mM citrate + 75 mM NaPO4 + 50 mM EDTA + 0.04% pH6.2 bisulfite, Column 4) 200 mM Mannitol + 125 citrate mM + 75 mM NaPO4 + 25 mM EDTA + 0.03% bisulfite pH6.2, Column 5) 200 mM Mannitol + 125 mM citrate + 75 mM NaPO4 + 50 mM EDTA + 0.03% pH6.2 bisulfite. The arrow represents the HA0 immunodetection signal.
[00049] Figure 9 shows the sequence of the DNA fragment synthesized for the assembly of construct # 590 (LC fragment; (SEQ ID NO. 15).
[00050] Figure 10 shows the sequence of the DNA fragment synthesized for the assembly of construct # 592 (HC fragment) (SEQ ID NO. 16).
[00051] Figure 11A and figure 11B show schematic representations of constructs # 595 (Figure 11A) and # R472 (Figure 11B), respectively.
[00052] Figure 12 SDS-PAGE comparison of antibodies purified from extracts produced by mechanical rupture (extraction in blender) and enzymatic digestion of cell walls. For each extraction method, two batches were processed and purified independently.
[00053] Figure 13A shows a comparison of the proportion of oligomanosidic N-glycans in C2B8 purified by mechanical disruption (extraction in blender) and enzymatic digestion of cell walls. Figure 13B shows a comparison of the proportion of complex N-glycans in C2B8 purified by mechanical disruption (extraction in a blender) and enzymatic digestion of cell walls. DETAILED DESCRIPTION
[00054] The present invention relates to methods of preparing plant-derived proteins. More specifically, the present invention provides methods for obtaining proteins, or proteins, or proteins, or protein superstructures, from plants and plant tissues.
[00055] The following description is of a preferred modality.
[00056] The present invention provides a method for obtaining a protein, or superstructure proteins of interest. The protein of interest may be present in the apoplast or extracellular compartment, corresponding to the plant cell portion excluding the protoplasty / spheroplast compartment. The method involves removal, digestion or both digestion and removal of the cellulosic plant cell wall that surrounds plant cells. Through digestion of the cell wall, the polymeric components of the cell wall are released, and the protein or proteins, or proteins, or protein superstructures of interest can be more readily released. By using this method, the protein or proteins, or proteins, or protein superstructures, of interest are enriched since the protoplast / spheroplast compartment that contains most of the proteins and components of the host cell is segregated from the apoplast. As noted below, the method as provided for in this application is still effective in obtaining a superstructure or protein protein of interest, if during the process the integrity of the protoplast / spheroplast compartment is lost, if the protoplast / spheroplast compartment is not intact, and if a portion of proteins and components of the protoplast / spheroplast compartment of the host cell is present in the apoplast fraction. Using the methods described below, if the integrity of the protoplast / spheroplast compartment is lost, the superstructure protein or proteins can still be separated from intact organelles, including mitochondria, chloroplast and other organelles, and beneficial results can still be obtained.
[00057] By "protein" or "protein of interest" (these terms are used interchangeably), is meant a protein, or protein subunit encoded by a nucleotide sequence, or coding region, which must be expressed within a plant or portion of the plant. Proteins can have a molecular weight of approximately 1 to approximately 100 kDa or any amount between them, for example, 1,2,4, 6, 8,10,12,14, 16, 18, 20, 22, 24, 26 , 28, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 kDa, or any amount between them. A protein can be monomeric, dimeric, trimeric or multimeric.
[00058] A superstructure protein, also called superstructure proteins, protein superstructure or superstructure protein, is a protein structure comprised of two or more polypeptides. Polypeptides can be the same, or different; if different, they may be present in a ratio of approximately 1: 1 to approximately 10: 1 or more. Protein superstructures may include, but are not limited to, protein rosettes, protein complexes, protein nanoparticles, glycoproteins, antibodies, polyclonal antibodies, monoclonal antibodies, single chain monoclonal antibodies, or virus-like particles, proteasomes, metabolons, transcription complexes, recombination complexes, photosynthetic complexes, membrane transport complexes, nuclear pore complexes, chimeric proteins, chimeric protein complexes, chimeric protein nanoparticles, chimeric glycoproteins, chimeric antibodies, chimeric monoclonal antibodies, chimeric monoclonal antibodies, or chimeric hemagglutinin ( THERE IS). If the superstructure proteins are a VLP, the VLP can be selected from the group of viral envelope proteins, viral structural proteins, viral capsid proteins, and viral envelope proteins. Plant-derived VLPs can comprise influenza (HA).
[00059] Typically a superstructure protein (protein superstructure), when assembled, is large, for example, having a molecular weight greater than 75kDa, for example, from approximately 75 to approximately 1500 kDa or any molecular weight between them. For example, superstructure proteins can have a molecular weight of approximately 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 850, 900, 950, 1000, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500 kDa, or any amount between them, the Subunits that combine to make up the superstructure proteins can be of a lower molecular weight, for example, each subunit having a molecular weight of approximately 1 kDa to approximately 500 kDa, or any amount between them. A superstructure protein can comprise a protein that exhibits a secondary structure, with one or more amino acids connected by hydrogen, for example, with residues in protein helices, a tertiary structure, having a three-dimensional configuration, or quaternary structure having an arrangement of multiple proteins folded or coiled protein molecules that form a multi-subunit complex.
[00060] A multiprotein complex (or protein complex) can comprise a group of two or more associated polypeptide chains. If the different polypeptide chains contain different protein domains, then the resulting multiprotein complex can have multiple catalytic functions. The protein complex can also be a multi-enzyme polypeptide, comprising multiple catalytic domains within a single polypeptide chain. Protein complexes are typically in the form of a quaternary structure. Examples of protein complexes that typically cannot remain intact using standard protein isolation protocols, but that can be obtained using the methods described in this application include proteasomes (for the degradation of peptides and proteins), metabolons (for energy production) oxidative), ribosomes (for protein synthesis; for example, as described in Pereira-Leal, JB; e. al., 2006, Philos Trans R Soc Lond B Biol Sei., 361 (1467): 507-517), complex transcription, recombination complexes, photosynthetic complexes, membrane transport complexes, nuclear pore complexes. The present method can be used for protein complexes obtained which are characterized by having stable or weaker protein domain-protein domain interactions.
[00061] Examples of a protein, or superstructure proteins, include, for example, but are not limited to, an industrial enzyme, for example, cellulase, xylanase, protease, peroxidase, subtilisin, a protein supplement, a nutraceutical, a product of added value, or a fragment thereof for animal feed, food, or use in both animal feed and food, a pharmaceutically active protein, for example, but not limited to growth factors, growth regulators, antibodies, antigens and fragments thereof, or their derivatives useful for immunization or vaccination and the like. Additional proteins of interest may include, but are not limited to, interleukins, for example, one or more between IL-1 to IL-24, IL-26 and IL-27, cytokines, Erythropoietin (EPO), insulin, G- CSF, GM-CSF, hPG-CSF, M-CSF or combinations thereof, interferons, for example, alpha interferon, beta interferon, gamma interferon, blood clotting factors, for example, Factor VIII, Factor IX, or tPA hGH, receptors, receptor agonists, antibodies, neuropolypeptides, insulin, vaccines, growth factors, for example, but not limited to epidermal growth factor, keratinocyte growth factor, transforming growth factor, growth regulators, antigens, autoantigens, fragments thereof, or combinations thereof.
[00062] A non-limiting example of a superstructure protein is an antibody. Antibodies are glycoproteins that have a molecular weight of approximately 100 to approximately 1000 kDa, or any amount between them. The antibodies comprise four polypeptide chains, two light chains and two heavy chains, which are joined by disulfide bonds. For example, which should not be considered limiting, each light chain can have a molecular weight of approximately 25 kDa, for example, approximately 20 to approximately 30 kDa or any amount in between, or more, for example, approximately 20 to approximately 300 kDa or any quantity between them, and is composed of two domains, a variable domain (VL) and a constant domain (CL). Each heavy chain can have a molecular weight of approximately 50 kDa, for example, approximately 30 to approximately 75 kDa, or any amount between them, or more, for example, approximately 30 to approximately 500 kDa or any amount between them, and consists of of a constant and variable region. Light and heavy chains contain several homologous sections consisting of similar, but not identical, groups of amino acid sequences. These homologous units consist of approximately 110 amino acids and are called immunoglobulin domains. The heavy chain contains a variable domain (VH) and three or four constant domains (CH1, CH2, CH3, and CH4, depending on the class of antibody or isotype). The region between the CH1 and CH2 domains is called the hinge region and allows flexibility between two Fab arms of the Y-shaped antibody molecule, allowing them to open and close to accommodate binding to two antigenic determinants separated by a fixed distance.
[00063] Another non-restrictive example of a superstructure protein is a VLP. The VLP can comprise a precursor form HAO, or the HA1 or HA2 domains conserved together in the form of disulfide bridges. A VLP can have an average size of approximately 20 nm at 1 pm, or any size between them, for example, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 120, 130, 140, 150160, 170, 180, 190 or 200 nm, or any size between them, for example, 100 nm, and can include a lipid membrane.
[00064] Proteins, or protein superstructures, may further comprise one or more lipids, phospholipids, nucleic acids, membranes or the like. Two or more polypeptides can be joined by a covalent bond, a disulfide bridge, charge interaction, hydrophobic attraction, van der waals, hydrogen bonds or the like. An example of a superstructure protein is a monoclonal antibody, a chimeric monoclonal antibody, a single chain monoclonal antibody, or a virus-like particle (VLP) that can be enveloped, or not enveloped, for example, a viral envelope protein, a viral structural protein, a viral capsid protein, or a viral envelope protein.
[00065] Proteins, or protein superstructures, can be produced in suitable host cells including plant host cells, and if desired further purified. While a chimeric monoclonal antibody, an influenza VLP and a chimeric influenza VLP are exemplified in this application, the methods described in this application can be used for any cytosolic protein or plant-derived superstructure proteins, or any protein or superstructure proteins derived from plant they locate, or are secreted to the apoplast.
[00066] The present invention also provides a method of preparing plant-derived proteins, or protein superstructures. The method involves obtaining a plant or plant material comprising plant-derived proteins, or protein superstructures, located within the apoplast; production of a fraction of protoplasts / spheroplasts, and a fraction of apoplasts from plant matter, the fraction of apoplasts comprising plant-derived proteins, or protein superstructures, and recovery of the apoplast fraction. If desired, plant-derived proteins, or protein superstructures, can be purified from the apoplast fraction.
[00067] The present invention also provides a method of preparing a superstructure protein or proteins, wherein the superstructure or protein proteins comprise a plant-derived lipid envelope, for example, a VLP comprising a plant-derived lipid envelope. The method includes obtaining a plant, or plant material comprising the superstructure proteins of interest, for example, VLP, treating the plant or plant material with an enzymatic composition to produce one or more of an apoplastic protein complex and a fraction of protoplast / spheroplast, and separation of one or more of an apoplastic protein complex from the protoplast fraction. One or more of an apoplastic protein complex comprises superstructure proteins or the VLP comprising a plant-derived lipid envelope.
[00068] The present invention also provides a method of preparing plant-derived proteins, or protein superstructures, comprising obtaining a plant or plant material comprising plant-derived proteins, or protein superstructures, digesting plant matter using an enzymatic composition which degrades the cell wall produced a digested fraction, and filtration of the digested fraction to produce a filtered fraction and recovery of plant-derived proteins, or protein superstructures, from the filtered fraction. In this method, the integrity of the protoplasts is not necessary.
[00069] A protoplast is a plant cell that has had its cell wall completely or partially removed. A spheroplast may have partial removal of the cell wall. A protoplast, a spheroplast, or both protoplast and spheroplast (protoplast / spheroplast) can be used as described in this application, and the terms as used in this application are interchangeable. The cell wall can be disrupted and removed mechanically (for example, through homogenization, mixing), the cell wall can be fully or partially digested enzymatically, or the cell wall can be removed using a combination of mechanical and enzymatic methods, for example, homogenization followed by treatment with cell wall digesting enzymes. Protoplasts can also be obtained from cultured plant cells, for example, liquid cultured plant cells, or solid cultured plant cells.
[00070] Reference works that present the general principles of plant tissue culture, plant cell culture, and production of protoplasts, spheroplasts and the like include: Introduction to Plant Tissue Culture, by MK Razdan 2nd Ed. (Science Publishers, 2003 ; which is incorporated into this application by reference), or see, for example, the following URL: molecular-plant- biotechnology.infoZplant-tissue-cultureZprotoplast-isolation.htm. The methods and techniques related to the production and handling of protoplast © (or spheroplasts) are reviewed in, for example, Davey MR et al., 2005 (Biotechnology Advances 23: 131-171; which is incorporated into this application by reference) . Reference works that present methods and those of protein biochemistry, molecular biology, general and similar principles include, for example, Ausubel et al, Current Protocols In Molecular Biology, John Wiley & Sons, New York (1998 and Supplements until 2001; incorporated in this application by reference); Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Plainview, New York, 1989 (which is incorporated into this application by reference); Kaufman et al, Eds., Handbook Of Molecular And Cellular Methods In Biology And Medicine, CRC Press, Boca Raton, 1995 (which is incorporated into this application by reference); McPherson, Ed., Directed Mutagenesis: A Practical Approach, IRL Press, Oxford, 1991 (which is incorporated into this application by reference).
[00071] Enzymes useful for digesting or degrading plant cell walls for release or protoplasts or spheroplasts are known to one skilled in the art and may include cellulase (EC 3.2.1.4), pectinase (EC 3.2.1.15), xylanase (EC 3.2. 1.8), chitinases (EC 3.2.1.14), hemicellulase, or a combination thereof. Non-limiting examples of suitable enzymes include a multicomponent enzyme mixture comprising cellulase, hemicellulase and pectinase, for example, MACEROZYME ™ (containing approximately: Cellulase: 0.1U / mg, Hemicellulase: 0.25U / mg and Pectinase: 0.5U / mg ). Other examples of commercial enzymes, enzyme mixtures and suppliers are listed in Table 1 (see: Introduction to Plant Tissue Culture, by MK Razdan 2nd Ed., Science Publishers, 2003).
[00072] Alternative names, and types of cellulases include endo-1,4-β-D-glycanase; β-1,4 glycanases; β-1,4-endoglycan hydrolase; cellulase A; cellulosin AP; endoglycanase D; alkali cellulase; cellulase A 3; celludextrinase; 9.5 cellulase; avicelase; pancelase SS and 1,4- (1,3; 1,4) -β- D-glycan 4-glycanhydrolase. Alternative names, and types of pectinases (polygalacturonases) include pectin depolymerase; pectinase; endopolygalacturonase; pectolase; pectin hydrolase; polygalacturonase pectin; endopolygalacturonase; poly-a-1,4-galacturonide glycanhydrolase; endogalacturonase; endo-D-galacturonase and poly (1,4-aD-galacturonide) glycanhydrolase. Alternative names, and types of xylanases include hemicellulase, endo- (1—> 4) -β-xylan 4-xylanhydrolase; endo-1,4-xylanase; xylanase; β-1,4 xylanases; endo-1,4-xylanase; endo-β-1,4-xylanase; endo-1,4-β-D-xylanase; 1,4-β-xylan xylanohydrolase; β-xylanase; β-1,4-xylan xylanhydrolase; endo-1,4-β-xylanase; β-D-xylanase. Alternative names, and types of chitinases include chitodextrinase; 1,4-β-poly- / V-acetylglycosaminidase; poly-β-glycosaminidase; β-1,4-poly-A / -acetyl glycosamidinase; poly [1,4- (A / -acetyl- β-D-glycosaminide)] glycanhydrolase. Table 1: Non-limiting examples of commercially available enzymes from protoplast isolation



[00073] The choice of a particular enzyme or combination of enzymes, and the reaction and concentration conditions may depend on the type of plant tissue used from which the apoplast and protoplast fraction comprising the VLPs is obtained. A mixture of cellulase, hemicellulase and pectinase, for example, a MACEROZYME ™ or Multifect pectinase, can be used in a concentration in the range of 0.01% to 2.5% (v / v), for example, 0.01, 0.02, 0.04, 0.06, 0.08, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0, 9, 1.0, 1.1.1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5% (v / v), or any amount between them. MACEROZYME ™ or Multifect can be used alone, or in combination with other enzymes, for example, cellulase, pectinase, hemicellulase or a combination thereof. Cellulase can be used at a concentration in the range of 0.1% to 5%, for example, 0.1, 0.25, 0.5, 0.75, 1.0, 1.25, 1.5, 1 , 75, 2.0, 2.25, 2.5, 2.75, 3.0, 3.25, 3.5, 3.75, 4.0, 4.25, 4.5, 4.75 , 5.0% (w / v) or any amount between them.
[00074] The enzyme solution (alternately referred to as a composition that degrades the cell wall, digestion solution) will generally comprise a buffer or buffer system, an osmotic, and one or more salts, divalent cations or other additives. The buffer or buffer system is selected to maintain a pH in the appropriate range for the enzymatic activity and stability of the protein (s), or VLP, to purify, for example, within the range of approximately pH 5.0 to approximately 8.0 , or any value between them. The selected pH used can vary depending on the VLP to be recovered, for example, the pH can be 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.2, 6, 4, 6.6, 6.8, 7.0, 7.2, 7.4, 7.6, 7.8, 8.0, or any pH in between. Examples of buffers or buffer systems include, but are not limited to, MES, phosphate, citrate and the like. One or more buffers or buffer systems can be combined in an enzyme solution (digestion solution); one or more buffers can be present in a concentration of 0 mM to approximately 200 mM, or any amount between them, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120 , 130, 140, 150, 160, 170, 180 or 190 mM or any amount in between. Depending on the convenience, an osmotic component can be added if desired. The osmotic and its concentration are selected to increase the osmotic strength of the enzyme solution. Examples of osmotic include mannitol, sorbitol or other sugar alcohols, polyethylene glycol (PEG) of varying lengths of polymer, and the like. The osmotic concentration ranges can vary depending on the plant species, the type of osmotic used and the type of plant tissue selected (species or organ of origin, for example, leaf or trunk) - generally the range is from 0M to approximately 0.8 M, for example, 0.05, 0.1, 0.15, 0.2, 0.25, 0.3. 0.35, 0.4, 0.5, 0.6, 0.7, or 0.75 M, or any concentration between them, for example, 0, 50, 100, 150, 200, 250, 300, 350 , 400, 450, 500, 550, 600 nM of mannitol, or any concentration between them. The osmotic concentration can also be expressed as a percentage (w / v). For some plants or types of tissue, it may be beneficial to employ a slightly hypertonic preparation, which can facilitate the separation of the plant cell plasma membrane from the cell wall. The osmotic can also be omitted during digestion.
[00075] Another parameter for establishing plant digestion is temperature. The temperature can be controlled if desired during the digestion process. The useful temperature range should be between 4 ° C and 40 ° C or any temperature between them, for example, from approximately 4 ° C to approximately 15 ° C, or any temperature between them, or from approximately 4 ° C to approximately 22 ° C, or any temperature between them. Depending on the temperature chosen, other experimental digestion parameters can be adjusted to maintain optimal extraction conditions.
[00076] Cations, salts or both can be added to improve the stability of the plasma membrane, cations, for example, divalents, such as Ca2 + or Mg2 +, from 0.5 to 50mM, or any concentration between them, salts, for example, CaCh, NaCI, CuSθ4, KNO3, and the like, from approximately 0 to approximately 750 mM, or any concentration between them, for example, 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700 or 750 mM. Other additives can also be added including a chelator, for example, but not limited to, EDTA, EGTA, from approximately 0 to approximately 200 mM, or any concentration between them, for example, 5, 10, 15, 20, 25, 50 , 75, 100, 125, 150, 175, 200 mM, or any concentration between them, a reducing agent to prevent oxidation such as, but not limited to, sodium bisulfite or ascorbic acid, at 0.005 to 0.4% or any amount between them, for example 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.1, 0, 15, 0.2, 0.25, 0.3, 0.35, 0.4%, or any amount between them, specific enzyme inhibitors (see below), and if desired, an inhibitor of leaf senescence, for example , cycloheximide, kinetin, or one or more polyamines.
[00077] The digestion solution may also comprise one or more between approximately 0 to approximately 600 mM mannitol, approximately 0 to approximately 500 mM NaCI, approximately 0 to approximately 50 mM EDTA, approximately 1% to approximately 2% cellulase v / v, pectinase from approximately 0 to approximately 1% v / v, sodium metabisulfite from approximately 0.03 to approximately 0.04%, citrate from approximately 0 to approximately 125 mM or NaPO4 from approximately 0 to 75 mM.
[00078] Plant matter can be treated to increase the access of enzymes or enzyme composition to the plant cell wall. For example, the epidermis of the leaf can be removed or 'peeled' before treatment with an enzyme composition. The vegetable matter can be cut into small pieces (manually, or with a grinding or cutting device, such as an Urschel cutter); the cutting of vegetable matter can also be infiltrated with an enzymatic composition under a partial vacuum (Nishimura and Beevers1978, Plant Physiol 62: 40-43; Newell et al., 1998, J. Exp Botany 49: 817-827). Mechanical disruption of plant matter can also be applied to plant tissues (Giridhar et al., 1989. Protoplasma 151: 151-157) before or during treatment with an enzyme composition. In addition, cultured plant cells, both liquid and solid cultures, can be used to prepare protoplasts or spheroplasts.
[00079] It may be desired to use an enzyme composition without, or having inactivated lipases or proteases. In some embodiments, one or more protease or lipase inhibitors can be included in the enzyme composition. Examples of lipase inhibitors include RHC80267 (SigmaAldrich); examples of protease inhibitors include E-64, Na2EDTA, Pepstatin, aprotinin, PMSF, Pefabloc, Leupeptin, bestatin and the like.
[00080] Any suitable method of mixing or stirring plant matter in the enzyme composition can be used. For example, the vegetable matter can be gently rotated or shaken in a pan or pan or through a rotary agitator, dropped on a rotating or oscillating drum. Precaution must be taken to minimize damage to the protoplasts (and / or spheroplasts) until they are removed from the digestion soup. The digestion vessel must then be selected.
[00081] As a non-limiting example, an enzyme composition comprising 1.5% cellulase (Onozuka R-10) and MACEROZYME ™ 0.375% in 500 mM mannitol, CaCh 10 m and MES 5 mM (pH 5.6) can be used for the production of protoplasts (or spheroplasts) from some Nicotiana tissues. As described in this application, the concentration of mannitol can also be varied from approximately 0 to approximately 500 mM, or any concentration between them. One skilled in the art, aware of the information described in this application, will be able to determine an enzyme composition suitable for the age and strain of Nicotiana sp, or for other species used for the production of VLPs.
[00082] Under rupture of the cell wall, or partial digestion of the cell wall, a fraction of protoplasts (comprising protoplasts and / or spheroplasts), and a "fraction of apoplast" are obtained. Alternatively, a "digested fraction" can be obtained. As noted below, the integrity of the protoplast fraction may not be necessary to produce high protein yields as described in this application, therefore, a fraction of apoplast or a digested fraction can be used for protein extraction, for example, but not limited to, VLPs, viral envelope proteins, viral structural proteins, viral capsid proteins, viral envelope proteins.
[00083] "Apoplast fraction" means a fraction that is obtained after enzymatic digestion, or partial enzymatic digestion, using enzymes that degrade the cell wall of plant matter in the presence of an osmotic and / or other ingredients that can be used to assist in maintaining the integrity of the protoplasty. The apoplast fraction may comprise some components that result from ruptured protoplasts (or spheroplasts). For example, the apoplast fraction can comprise approximately 0 to approximately 50% (v / v) or any amount between them, from the components of the protoplast fraction, or 0, 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50% (v / v) or any amount between them from the components of the protoplast fraction.
[00084] A "digested fraction" is understood to mean the fraction that remains after enzymatic digestion, or partial enzymatic digestion, using enzymes that degrade the cell wall of plant matter, however, the integrity of the protoplasty is not necessary, and the digested fraction it may comprise intact, broken, or both intact and broken protoplasts. The composition comprising enzymes that degrade the cell wall used to produce the digested fraction may comprise an osmotic, or the osmotic may be present in a reduced amount compared to the amount present in standard procedures used to obtain protoplasts, or the osmotic may be absent from the composition. The digested fraction comprises the apoplast fraction and the protoplast / spheroplast fraction, however, the protoplast / spheroplast fraction may be intact or not. The digested fraction contains intracellular and extracellular components. Intracellular components can be found in the form of protoplasts / spheroplasts if an osmotic is used to keep the protoplast / spheroplasts intact. If no osmotic is used in the digestion solution, then the protoplasts / spheroplasts can be disrupted and the intracellular and extracellular components can be combined in the digested fraction. As described in this application, the proteins of interest, or protein superstructures of interest, can be separated from components of the digested fraction using any suitable technique. Without claiming to be limited by theory, the cell wall digestion step can detach the polymeric components of the cell wall and assist in the release of proteins, or protein superstructures, otherwise trapped within the cell wall. This protocol also minimizes contamination of proteins, or protein superstructures, with intracellular components. The proteins or protein superstructures of interest can be separated from cell fragments after enzymatic digestion using low speed centrifugation followed by filtration, depth filtration, sedimentation, precipitation, for example, but not limited to ammonium sulfate precipitation, or combination of to obtain a separate fraction comprising the proteins or protein superstructures of interest.
[00085] If an osmotic is used, the protoplast / spheroplast fraction, or fraction comprising protoplasts, can be separated from the apoplast fraction using some suitable technique, for example, but not limited to, centrifugation, filtration, depth filtration, sedimentation , precipitation or a combination thereof to obtain a separate fraction comprising the proteins or protein superstructures of interest and / or comprising the protoplasts / spheroplasts comprising the proteins or protein superstructures of interest.
[00086] The separated fraction can be, for example, a supernatant (if centrifuged, sedimented or precipitated), or a filtrate (if filtered), and is enriched in proteins, or protein superstructures. The separated fraction can be further processed for isolation, purification, concentration or a combination of these, proteins, or protein superstructures, for example, through additional centrifugation, precipitation, chromatographic steps (for example, size exclusion chromatography, ion exchange, affinity), tangential flow filtration, or combination thereof. The presence of purified proteins, or protein superstructures, can be confirmed by, for example, using native Western analysis or SDS-PAGE, using an appropriate antibody for detection, capillary electrophoresis, or any other method as would be evident to one skilled in the art .
[00087] The apoplast is the portion of the plant cell outside the plasma membrane, and includes the cell wall and intercellular spaces of the plant. While it is preferred that the integrity of the protoplasts (and / or spheroplasts) is maintained during further digestion and processing, it is not necessary for the protoplasts to remain intact in order to enrich proteins, or protein superstructures.
[00088] During synthesis, proteins, or protein superstructures, can be secreted out of the plasma membrane. If the superstructure proteins are a VLP, they are an average size of approximately 20 nm at 1 pm, or any size in between. If the superstructure proteins are an antibody, they are of a molecular weight of approximately 100 kDa to approximately 1000 kDa, or any size in between. Due to their size, once synthesized, proteins, or protein superstructures, may remain trapped between the plasma membrane and the cell wall and may be inaccessible for further isolation or purification using standard mechanical methods used to obtain plant proteins. In order to maximize yields, minimize contamination of the fraction of superstructure proteins with cell proteins, maintain the integrity of proteins, or protein superstructures, and, where necessary, the lipid envelope or associated membrane, methods of disrupting the cell wall for release of proteins, or protein superstructures, that minimize mechanical damage to the protoplast and / or spheroplasts may be useful, such as the enzymatic methods described in this application. However, it is not necessary for the integrity of all protoplasts to be preserved during the procedure.
[00089] A superstructure protein, for example, a VLP produced in a plant can be complexed with lipids derived from the plant. The lipids derived from the plant may be in the form of a lipid bilayer, and may also comprise an envelope surrounding the VLP. Plant-derived lipids may comprise lipid components of the plant's plasma membrane where VLP is produced, including, but not limited to, phosphatidylcholine (PC), phosphatidylethanolamine (PE), glycosphingolipids, phytosterols or a combination thereof. A lipid derived from the plant may alternatively be referred to as a 'vegetable lipid'. Examples of phytosterols are known in the art, and include, for example, stigmasterol, sitosterol, 24-methylcholesterol and cholesterol (Mongrand et al., 2004, J. Biol Chem 279: 36277-86).
[00090] Polypeptide expression can be directed to any intracellular or extracellular space, organelle or tissue of a plant as desired. In order to locate the expressed polypeptide at a particular position, the nucleic acid encoding the polypeptide can be linked to a nucleic acid sequence that encodes a signal peptide or leader sequence. A signal peptide may alternatively be referred to as a transit peptide, signal sequence or leader sequence. Signal peptides or peptide sequences for targeting the location of a polypeptide expressed in the apoplast include, but are not limited to, a native signal (relative to the protein) or leader sequence, or a heterologous signal sequence, for example, but not limited a, a rice amylase signal peptide (McCormick 1999, Proc Natl Acad Sci USA 96: 703-708), a disulfide protein isomerase (PDI) signal peptide has the amino acid sequence:
[00091] MAKNVAIFGLLFSLLLLVPSQIFAEE; SEQ ID NO. 10, a protein-related plant pathogenesis (PRP; Szyperski et al. PNAS 95: 2262-2262), for example, the protein related to tobacco 2 plant pathogenesis (PRP), a human monoclonal antibody signal peptide (SP, or leader sequence), or any signal peptide that is native to the protein.
[00092] In some examples, an expressed polypeptide can accumulate in the specific intercellular or extracellular space (such as the apoplast), organelle or tissue, for example, when the polypeptide is expressed and secreted in the absence of a signal peptide or peptide from Traffic.
[00093] The term "virus-like particle" (VLP), or "virus-like particles" or "VLPs" refers to structures that self-assemble and comprise surface viral proteins, for example, an influenza HA protein, or protein HA of chimeric influenza. Chimeric VLPs and chimeric VLPs are generally morphologically and antigenically similar to virions produced in an infection, but do not have enough genetic information for replication and are therefore non-infectious.
[00094] By "chimeric protein" or "chimeric polypeptide" is meant a protein or polypeptide comprising amino acid sequences from two or more sources, for example, but not limited to, two or more types of influenza or subtypes, which are fused as a single polypeptide. The chimeric protein or polypeptide can include a signal peptide that is the same (i.e., native), or heterologous to the rest of the polypeptide or protein. The chimeric polypeptide or chimeric protein can be produced as a transcript of a chimeric nucleotide sequence, and remain intact, or if necessary, the chimeric polypeptide or chimeric protein can be cleaved after synthesis. The intact chimeric protein, or cleaved portions of the chimeric protein, can combine to form a multimeric protein. A chimeric protein or a chimeric polypeptide can also include a protein or polypeptide that comprises subunits that associate through disulfide bridges (i.e., a multimeric protein). For example, a chimeric polypeptide comprising amino acid sequences from two or more sources can be processed into subunits, and the associated subunits via disulfide bonds to produce a chimeric polypeptide or chimeric protein. A non-limiting example of a chimeric protein is a chimeric monoclonal antibody, for example, C2B8, or chimeric VLP, for example, but not limited to proteins and VLPs have produced constructs numbered 690, 691, 696, 734, 737, 745 or 747 ( Table 2) as described in provisional US patent application 61 / 220,161 and PCT / CA2010 / 000983 (which are incorporated in this application by reference).
[00095] The protein or suprastructure proteins can be a glycoprotein, and the method as described in this application involving extraction by digestion of the cell wall can be applied to plants that coexpress a glycoprotein and one or more enzymes to modify the N- profile glycosylation as described in WO 20008/151440 (Modifying glycoprotein production in plants'which is incorporated in this application by reference) to favor the recovery of glycoproteins carrying modified mature N-glycans. For example, mature N-glycans may be free of xylose and fucose residues, or exhibit reduced fucosylated, xylosylated N-glycans, or both, fucosylated and xylosylated. Alternatively, a protein of interest comprising a modified glycosylation pattern can be obtained, in which the protein lacks fucosylation, xylation, or both, and comprises increased galatosylation.
[00096] The modified N-glycosylation profile can be obtained by coexpressing a plant, a portion of a plant, or a plant cell, of a nucleotide sequence that encodes a first nucleotide sequence that encodes a hybrid protein (GNT1-GalT) , comprising a CTS domain (i.e., the cytoplasmic tail, transmembrane domain, trunk region) of N-acetylglycosaminyl transferase (GNT1) fused to a catalytic domain of beta-1,4galactosyltransferase (GaIT), the first nucleotide sequence operatively linked to a first regulatory region that is active in the plant, and a second nucleotide sequence to encode the superstructure proteins of interest, the second nucleotide sequence operatively linked to a second regulatory region that is active in the plant, and coexpression of the first and second nucleotide sequences for synthesize a superstructure protein of interest comprising glycans with the modified N-glycosylation profile as described in WO 20008/151440.
[00097] The superstructure proteins can be influenza hemagglutinin (HA), and each of the two or more amino acid sequences that make up the polypeptide can be obtained from different HA's to produce a chimeric HA, or chimeric influenza HA. A chimeric HA can also include an amino acid sequence comprising the heterologous signal peptide (a chimeric HA pre-protein) which is cleaved after synthesis. Examples of HA proteins that can be used in the invention described in this application can be found in WO 2009/009876; WO 2009/076778; WO 2010/003225 (which are incorporated in this application by reference). A nucleic acid encoding a chimeric polypeptide can be described as a "chimeric nucleic acid", or "chimeric nucleotide sequence". A virus-like particle comprised of chimeric HA can be described as a "chimeric VLP". Chimeric VLPs are further described in PCT patent application No. PCT / CA2010 / 000983 filed on June 25, 2010, and US Provisional Patent Application No. 61 / 220,161 (filed on June 24, 2009; which is incorporated into this order by reference). VLPs can be obtained from the expression of native or chimeric HA.
[00098] The HA of VLPs prepared according to the method provided by the present invention includes known sequences and variant HA sequences that can be developed or identified. In addition, VLPs produced as described in this application do not comprise neuraminidase (NA) or other components, for example, M1 (protein M), M2, NS and the like. However, NA and M1 can be expressed with HA and NPVs comprising HA should be desired.
[00099] Generally, the term "lipid" refers to naturally occurring fat-soluble (lipophilic) molecules. A chimeric VLP produced in a plant according to some aspects of the invention can be complexed with lipids derived from the plant. The plant-derived lipids may be in the form of a lipid bilayer, and may further comprise an envelope surrounding the VLP. Plant-derived lipids may comprise lipid components of the plasma membrane of the plant where VLP is produced, including phospholipids, tri-, di- and monoglycerides, as well as fat-soluble sterol or metabolites comprising sterols. Examples include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol, phosphatidyl serine, glycophingolipids, phytosterols or a combination thereof. A plant-derived lipid may alternatively be referred to as a 'vegetable lipid'. Examples of phytosterols include campesterol, stigmasterol, ergosterol, brassicasterol, delta-7-stigmasterol, delta-7-avenasterol, daunosterol, sitosterol, 24-methylcholesterol, cholesterol or beta-sitosterol (Mongrand et al., 2004, J. Biol Chem 279 : 36277-86). As one skilled in the art will readily understand, the lipid composition of a cell's plasma membrane may vary with the culture or growth conditions of the cell or organism, or species, from which the cell is obtained.
[000100] Cell membranes generally comprise lipid bilayers, as well as proteins of various functions. Localized concentrations of particular lipids can be found in the lipid bilayer, referred to as 'lipid rafts'. These lipid raft microdomains can be enriched in sphingolipids and sterols. Without claiming to be limited by theory, lipid rafts can play significant roles in endo and exocytosis, entry or exit of viruses or other infectious agents, inter-cellular signal transduction, interaction with other structural components of the cell or organism, such as intracellular matrices and extracellular.
[000101] VLPs comprising a lipid envelope have been previously described in WO 2009/009876; WO 2009/076778 and WO 2010/003225 (which are incorporated in this application by reference). With reference to the influenza virus, the term "hemagglutinin" or "HA" as used in this application refers to a structural glycoprotein of the influenza virus particles. The HA of the present invention can be obtained from any subtype. For example, HA can be of the subtype H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, or H16, or of influenza types B or C. The recombinant HA of the present invention can also comprise an amino acid sequence based on the sequence of any hemagglutinin. The structure of influenza hemagglutinin is well studied and demonstrates a high degree of conservation in the secondary, tertiary and quaternary structure. This structural conservation is observed although the amino acid sequence may vary (see, for example, Skehel and Wiley, 2000 Ann Rev Biochem 69: 531-69; Vaccaro et al 2005; which is incorporated into this application by reference). Nucleotide sequences encoding HA are well known, and are available, for example, in the BioDefense and Public Health Database (now Influenza Research Database; Squires et al., 2008 Nucleic Acids Research 36: D497-D503) for example, at URL: biohealthbase.org/GSearch/home.do decorator=lnfluenza) or in the databases maintained by the National Center for Biotechnology Information (NCBI; for example, at the URL: ncbi.nlm.nih.gov/sites/entrez db=nuccore&cmd = search & term = influenz a), both of which are incorporated into this application by reference.
[000102] The present invention also pertains to methods of preparation, isolation, or both preparation and isolation of VLPs, including VLPs of influenza viruses that infect humans, or animal hosts, for example, primates, horses, pigs, birds, sheep, birds aquatic, migratory birds, quail, ducks, geese, poultry, chicken, camel, canines, dogs, felines, cats, tiger, leopard, civet, foxes, weasel, ferrets, domestic animals, livestock, mice, rats, seal, whale and the like. Some influenza viruses can infect more than one host animal. Amino acid variation is tolerated in influenza virus hemagglutinins. This variation provides new strains that are constantly identified. Infectivity among new strains can vary. However, the formation of hemagglutinin trimers, which later form VLPs is maintained. The present invention also includes methods of preparing any plant-derived VLP, regardless of the HA subtype or sequence, or chimeric HA comprising the VLP, or species of origin.
[000103] The correct folding of suprastructure proteins can be important for protein stability, formation of multimers, formation and function of the protein. The folding of a protein may be influenced by one or more factors, including, but not limited to, the sequence of the protein, the relative abundance of the protein, the degree of intracellular accumulation, the availability of cofactors that can transiently bind or associate with the folded, partially folded or open protein, in the presence of one or more chaperone proteins, or the like.
[000104] Heat shock proteins (Hsp) or stress proteins are examples of chaperone proteins, which can participate in several cellular processes including protein synthesis, intracellular trafficking, prevention of incorrect folding, prevention of protein aggregation, assembly and disassembly of complexes proteins, protein folding, and protein breakdown. Examples of such chaperone proteins include, but are not limited to, Hsp60, Hsp65, Hsp70, Hsp90, HsplOO, Hsp20-30, Hsp10, HspWO- 200, HsplOO, Hsp90, Lon, TF55, FKBPs, cyclophilins, CIpP, GrpE, ubiquitin, calnexin and protein disulfide isomerases (see, for example, Macario, AJL, Cold Spring Harbor Laboratory Res. 25: 59- 70. 1995; Parsell, DA & Lindquist, S. Ann. Rev. Genet. 27: 437-496 (1993 ); US Patent No. 5,232,833). Chaperone proteins, for example, but not limited to Hsp40 and Hsp70 can be used to ensure the folding of a chimeric HA (PCT Patent Application No. PCT / CA2010 / 000983 filed on June 25, 2010, and Provisional Patent Application US No. 61 / 220,161, filed June 24, 2009; WO 2009/009876 and WO 2009/076778, all of which are incorporated into this application by reference). Protein disulfide isomerase (PDI; Accession No. Z11499) can also be used.
[000105] Once recovered, proteins, or protein superstructures, can be evaluated for structure, size of potency or activity, for example, through, but not limited to, electron microscopy, light scattering, size exclusion chromatography, HPLC, Western blot analysis, electrophoresis, ELISA, activity based assays, eg hemagglutination assay, or any other suitable assay. These and other methods for assessing the size, concentration, activity and composition of VLPs are known in the art.
[000106] For preparative size exclusion chromatography, a preparation comprising proteins, or protein superstructures, can be obtained by the methods described in this application, and the insoluble material removed by centrifugation. Precipitation with PEG or ammonium sulfate can also be useful. The recovered protein can be quantified using conventional methods (for example, Bradford Assay, BCA), and the extract passed through a size exclusion column, using for example, SEPHACRYL ™, SEPHADEX ™ or similar medium, chromatography using an exchange column ionic, or chromatography using an affinity column, and the active fractions collected. Protein complexes can also be obtained using affinity-based magnetic separation, for example, with Dynabeads ™ (Invitrogen), and eluting the protein complex from Dynabeads ™. A combination of the chromatographic and separation protocols can also be used. After chromatography, or separation, the fractions can be further analyzed by protein electrophoresis, immunostaining, ELISA, activity-based assays as desired, to confirm the presence of the superstructure proteins.
[000107] If the superstructure protein is a VLP, then a hemagglutination assay can be used to evaluate the hemagglutinating activity of the fractions containing the VLP, using methods well known in the art. Without wishing to be limited by theory, the ability of HA to bind to RBC of different animals is driven by the affinity of HA to sialic acids a2,3 or a2,3 and the presence of these sialic acids on the surface of RBC. HA of horses and birds from influenza viruses agglutinates red blood cells of all species, including turkeys, chickens, ducks, guinea pigs, humans, sheep, horses and cows; whereas human HA will bind to erythrocytes from turkey, chickens, ducks, guinea pigs, humans and sheep (Ito T. et al, 1997, Virology, 227: 493-499; Medeiros R et al, 2001. Virology 289: 74-85).
[000108] A haemagglutination inhibition assay (Hl or HAI) can also be used to demonstrate the effectiveness of antibodies induced by a vaccine, or vaccine composition comprising chimeric HA or chimeric VLP that can inhibit red blood cell (RBC) clumping ) by recombinant HA. The titers of hemoagglutination inhibitory antibody in serum samples can be assessed by HAI microtiter (Aymard et al1973). Erythrocytes of any of several species can be used - for example, horse, turkey, chicken or the like. This assay provides indirect information about the assembly of the HA trimer on the surface of the VLP, confirming the proper presentation of antigenic sites in HAs.
[000109] HAI cross-reactivity titers can also be used to demonstrate the effectiveness of an immune response to other strains of the virus related to the vaccine subtype. For example, the serum of an individual immunized with a vaccine composition comprising a chimeric hemagglutinin comprising an HDC of a first type or subtype of influenza can be used in an HAI assay with a second whole strain of virus or virus particles, and the HAI title determined.
[000110] Influenza VLPs prepared by the methods of the present invention can be used in conjunction with an existing influenza vaccine, to supplement the vaccine, make it more effective, or reduce the required dosages for administration. As would be known to one skilled in the art, the vaccine can be directed against one or more influenza viruses. Examples of suitable vaccines include, but are not limited to, those commercially available from Sanofi-Pasteur, ID Biomedical, Merial, Sinovac, Chiron, Roche, Medlmmune, GlaxoSmithKline, Novartis, Sanofi-Aventis, Serono, Shire Pharmaceuticals and the like. If desired, the VLPs of the present invention can be mixtures with a suitable adjuvant as would be known to one skilled in the art. In addition, the VLP produced in accordance with the present invention can be coexpressed with other protein components or reconstituted with other influenza VLPs or protein components, for example, neuraminidase (NA), M1 and M2. It can also be coexpressed or reconstituted with another VLP made from vaccine proteins, such as malaria antigens, HIV antigens, respiratory syncytial virus (RSV) antigens and the like.
[000111] The methods of transformation and regeneration of transgenic plants, plant cells, plant matter or seeds comprising proteins, or protein superstructures, are established in the art and known to one skilled in the art. The method of obtaining transformed and regenerated plants is not critical to the present invention.
[000112] "Transformation" means the interspecific transfer of genetic information (nucleotide sequence) that is manifested genotypically, phenotypically or both. The interspecific transfer of genetic information from a chimeric construct to a host can be hereditary (that is, integrated into the host's genome) and the transfer of genetic information considered stable, or the transfer can be transient and the transfer of genetic information is not inheritable .
[000113] The term "vegetable matter" means any material derived from a plant. Plant matter can comprise an entire plant, tissue, cells, or any fraction thereof. In addition, plant matter may comprise intracellular plant components, extracellular plant components, liquid or solid plant extracts, or a combination thereof. In addition, plant matter may comprise plants, plant cells, tissue, a liquid extract, or a combination thereof, from plant leaves, trunks, fruit, roots or a combination thereof. The vegetable matter can comprise a plant or portion of it that has not been subjected to any processing step. A portion of a plant can comprise plant matter. Plants or plant matter can be collected or obtained by any method, for example, the entire plant can be used, or leaves or other tissues specifically removed for use in the described methods. Transgenic plants that express and secrete VLPs can also be used as a starting material for processing as described in this application.
[000114] The constructs of the present invention can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, infiltration and the like. For reviews of such techniques see, for example, Weissbach and Weissbach, Methods for Plant Molecular Biology, Academy Press, New York VIII, pages 421-463 (1988); Geierson and Corey, Plant Molecular Biology, 2nd Ed. (1988); and Miki and Iyer, Fundamentals of Gene Transfer in Plants. In Plant Metabolism, 2nd Ed. DT. Dennis, DH Turpin, DD Lefebrve, DB Layzell (eds), Addison-Wesley, Langmans Ltd. London, pages 561-579 (1997). Other methods include direct DNA entry, the use of liposomes, electroporation, for example, using protoplasts, microinjection, microprojectiles or capillary crystals, and vacuum infiltration. See, for example, Bilang, et al. (Gene 100: 247-250 (1991), Scheid et al. (Mol. Gen. Genet. 228: 104-112, 1991), Guerche et al. (Plant Science 52: 111-116, 1987), Neuhause et al (Theor. Gineto de Appl. 75: 30-36, 1987), Klein et al., Nature 327: 70-73 (1987); Howell et al. (Science 208: 1265, 1980), Horsch et al. ( Science 227: 1229-1231, 1985), DeBlock et al., Plant Physiology 91: 694-701, 1989), Methods for Plant Molecular Biology (Weissbach and Weissbach, eds., Academic Press Inc, 1988), Methods for Plant Molecular Biology (Schuler and Zielinski, eds., Academic Press Inc, 1989), Liu and Lomonosossoff (J. Virol Meth, 105: 343-348, 2002), Pat. U.S. Nos. 4,945,050; 5,036,006; 5,100,792; 6,403,865; 5,625,136, (all of which are hereby incorporated by reference).
[000115] Transient expression methods can be used to express the constructs of the present invention (see Liu and Lomonossoff, 2002, Journal of Virological Methods, 105: 343-348; which is incorporated in this application by reference). Alternatively, a vacuum-based transient expression method, as described in PCT Publications WO 00/063400, WO 00/037663 (incorporated in this application by reference) can be used. These methods may include, for example, but are not limited to, an Agroinoculation or Agro infiltration method, however, other transient methods can also be used as noted above. With Agroinoculation or Agro infiltration, a mixture of Agrobacteria comprising the desired nucleic acid enters the intercellular spaces of a tissue, for example, the leaves, the aerial portion of the plant (including trunk, leaves and flower), another portion of the plant (trunk, root , flower), or whole plant. After crossing the epidermis, Agrobacteriuminfects and transfers copies of t-DNA to the cells. T-DNA is episomally transcribed and the mRNA translated, leading to the production of the protein of interest in infected cells, however, the passage of t-DNA within the nucleus is transient.
[000116] The sequences described in this application are summarized below.


[000117] The present invention will be further illustrated in the following examples. However, it should be understood that these examples are for illustrative purposes only, and should not be used to limit the scope of the present invention in any way. Assembly of expression cassettes
[000118] The constructs that can be used for the production of VLPs are described in Provisional Patent Application US 61 / 220,161 and PCT / CA2010 / 000983 (which are incorporated into this application by reference), WO 2009/009876, WO 2009/076778 and WO2010 / 003225 (all of which are incorporated in this application by reference). The constructs can also include those listed in Table 2. The assembly of these constructs is described in WO 2009/009876, WO 2009/076778, W02010 / 003225 and US 61 / 220,161. However, other constructs that comprise known HAs, including, but not limited to those provided in Table 2, and combined with similar or different regulatory and promoter elements, can also be used for the production of VLPs as described in this application. Table 2: Non-limiting examples of the constructs that can be used for the production of hemagglutinin.



[000119] CPMV-HT expression cassettes included the 35S promoter to control the expression of a mRNA comprising a coding sequence of interest flanked, in the 5 'region by 1-512 nucleotides of the Cowpea mosaic RNA2 (CPMV) with mutated ATG at positions 115 and 161 and in the 3 'region, by nucleotides 3330-3481 of CPMV RNA2 (corresponding to the 3' UTR) followed by the NOS terminator. Plasmid pBD-C5-1LC, (Sainsbury et al. 2008; Plant Biotechnology Journal 6: 82-92 and PCT Publication WO 2007/135480), was used for the assembly of CPMV-HT-based hemagglutinin expression cassettes. The mutation of ATGs at position 115 and 161 of CPMV RNA2 was done using a PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). Two separate PCRs were performed using pBD-C5-1LC as a template. The primers of the first amplification were pBinPlus.2613c (SEQ ID NO: 3) and Mut-ATG115.r (SEQ ID NO: 4). The initiators of the second amplification were Mut-ATG161.c (SEQ ID NO: 5) and LC-C5-1.110r (SEQ ID NO: 6). The two fragments were then mixed and used as a template for a third amplification using pBinPlus.2613c (SEQ ID NO: 3) and LC-C5-1.110r (SEQ ID NO: 6) as primers. The resulting fragment was digested with Pad and Apal and cloned into pBD-C5-1LC digested with the same enzyme. The expression cassette generated was called 828.
[000120] Assembly of H5 A / lndonesia / 5/2005 in the expression cassette CPMV - / - / T (construct number 685).
[000121] The assembly of this cassette is described in WO 2009/009876, WO 2009/076778 and WO2010 / 003325, which are incorporated in this application by reference.
[000122] Briefly, the H5 coding sequence of A / Indonesia / 5/2005 was cloned into CPMV - / - / T as follows: the restriction sites of Apal (immediately upstream of the initial ATG) and Stul (immediately downstream of a stop codon) were added to the hemagglutinin coding sequence by performing a PCR amplification with Apal-H5 (A-lndo) .lc (SEQ ID NO: 7) and H5 (A-lndo) -Stul primers. 1707r (SEQ ID NO: 8) using construct number 660 (D'Aoust et al., Plant Biotechnology Journal 6: 930-940 (2008)) as a template. Construct 660 comprises an alfalfa plastocyanin and 5 'UTR promoter, A / lndonesia / 5/2005 H5 hemagglutinin coding sequence (Construct # 660), 3' UTR alfalfa plastocyanine and terminator sequences (SEQ ID NO: 9; Figure 5). The resulting fragment was digested with Apal and Stul restriction enzymes and cloned in construct number 828, previously digested with the same enzymes. The resulting cassette was named construct number 685 (Figures 1.2). Silencing suppressors
[000123] Post-transcriptional gene silencing (PTGS) may be involved in limiting the expression of transgenes in plants, and the co-expression of a potato Y virus silencing suppressor (HcPro) can be used to neutralize specific degradation of transgene mRNAs (Brigneti et al., 1998). Alternative silencing suppressors are well known in the art and can be used as described in this application (Chiba et al., 2006, Virology 346: 7-14; which is incorporated in this application by reference), for example, but not limited to, TEV-p1 / HC-Pro (Tobbaco etch virus-p1 / HC-Pro), BYV-p21, p19 from Tomato bushy stunt virus (TBSV p19), Capsid protein from Tomato crinkle virus (TCV-CP), 2b virus the Pepino mosaic; CMV-2b), p25 from the Potato X virus (PVX-p25), p11 from the Potato M virus (from PVM-p11), p11 from the Potato S virus (PVS-p11), p16 from the Blueberry burn virus, (BScV-p16), p23 of the Citrus tristeza virus (CTV-p23), p24 of the virus associated with the winding of Vine 2, (GLRaV-2 p24), p10 of the virus A of Vine, (GVA-p10), p14 of the virus B of the Vine (GVB-p14), p10 of the latent Heracleum virus (HLV-p10), or p16 latent common garlic virus (GCLV-p16). Therefore, a silencing suppressor, for example, but not limited to, HcPro, TEV-P1 / H-pro, BYV-p21, TBSV p19, TCV-CP, CMV-2b, PVX-p25, PVM-p11, PVS -p11, BScV-p16, CTV-p23, GLRaV-2 p24, GBV-p14, HLV-p10, GCLV-p16 or GVA-p10, can be co-expressed together with the nucleic acid sequence encoding the protein of interest to still ensure high levels of protein production within a plant.
[000124] The construction of p19 is described in that described in WO 2010/0003225 (which is incorporated in this application by reference). Briefly, the coding sequence for the p19 protein of the tomato bushy stunt virus (TBSV) was linked to the alfalfa plastocyanin expression cassette by the PCR-based ligation method presented in Darveau et al. (Methods in Neuroscience 26: 77-85 (1995)). In a first round of PCR, a segment of the plastocyanin promoter was amplified using Plasto-443c primers:
[000125] GTATTAGTAATTAGAATTTGGTGTC (SEQ ID NO: 11) and supP19-plasto.r
[000126] CCTTGTATAGCTCGTTCCATTTTCTCTCAAGATG (SEQ ID NO: 12) with construct 660 (described in WO 2010/0003225, which is incorporated in this application by reference) as a template. In parallel, another fragment containing the p19 coding sequence was amplified with the supP19-1c primers.
[000127] ATGGAACGAGCTATACAAGG (SEQ ID NO: 13) and SupP19-Sacl.r
[000128] AGTCGAGCTCTTACTCGCTTTCTTTTTCGAAG (SEQ ID NO: 14) using construct 35S: p19 as described in Voinnet et al. (The Plant Journal 33: 949-956 (2003)) as a template. The amplification products are then mixed and used as a template for a second amplification cycle (assembly reaction) with the Plasto-443c and SupP19-Sacl.r primers. The resulting fragment was digested with BamHI (in the plastocyanin promoter) and Saci (at the end of the p19 coding sequence) and cloned in construct number 660, previously digested with the same restriction enzymes to give construct number R472. Plasmids were used to transform Agrobacteium tumefaciens (AGL1; ATCC, Manassas, VA 20108, the USA) by electroporation (Mattanovich et al., 1989). The integrity of all A. tumefaciens strains was confirmed by restriction mapping. The A. tumefaciens strain comprising R472 (Figure 11B) is called "AGL1 / R472".
[000129] The HcPro construct (35HcPro) was prepared as described in Hamilton et al. (2002). All clones were sequenced to confirm the integrity of the constructs. Plasmids were used to transform Agrobacteium tumefaciens (AGL1; ATCC, Manassas, VA 20108, the USA) by electroporation (Mattanovich et al., 1989). The integrity of all A. tumefaciens strains was confirmed by restriction mapping. Preparation of vegetable biomass, inoculum, aqroinfiltração, and harvest
[000130] Nicotiana benthamiana plants were grown from seeds in compartments filled with a commercial peat moss substrate. The plants were allowed to grow in the greenhouse under a 16/8 photoperiod and a temperature regime of 25 ° C during the day and 20 ° C at night. Three weeks after planting, individual seedlings were chosen, transplanted into pots and left to grow in the greenhouse for an additional three weeks under the same environmental conditions. After six weeks, the plants have an average weight of 80 g and 30 cm in height.
[000131] The AgrobacteriumAGL1 strain was transfected (electroporation) with the constructs as identified below, using the methods described by D'Aoust et al 2008 (Plant Biotechnology Journal 6: 930-940). Agrobacteriumtransfected were grown in YEB medium supplemented with 10 mM 2- (N-morpholino) ethanesulfonic acid (MES), 20 pM acetosyringone, 50 pg / ml kanamycin and 25 pg / ml carbenicillin pH 5.6 at an ODeoo between 0 , 6 and 1.6. The Agrobacterium suspensions were centrifuged before use and resuspended in an infiltration medium (10 mM MgCh and 10 mM MES pH 5.6).
[000132] The plants were agro-filtered as described in D'Aoust et al (supra). Briefly, for vacuum infiltration, A. tumefaciens suspensions were centrifuged, resuspended in the infiltration medium and stored overnight at 4 ° C. On the day of infiltration, the culture batches were diluted in 2.5 culture volumes and heated before use. The whole plants of N. benthamiana were placed inverted in the bacterial suspension in an airtight stainless steel tank under a vacuum of 20-40 Torr for 2 minutes. Unless otherwise specified, all infiltrations were performed as co-infiltration with a R472-transformed bacterial (strain AGL1 / R472) at a 1: 1 ratio. After vacuum infiltration, the plants were returned to the greenhouse during a 4-6 day incubation period until harvest. Leaf sampling and total protein extraction (mechanical homogenization)
[000133] After the incubations of 4, 5, 6, 7 and 8 days, the aerial part of the plants was collected and used immediately. The total soluble proteins were extracted by homogenizing the plant tissue in 3 volumes of 50 mM cold Tris pH 8.0, 0.15 M NaCI containing 1% Trition X-100 and 0.004% sodium metabisulfite. The plant tissue was mechanically homogenized using a POLYTRON ™, grinding with gral and mortar, or with COMITROL ™ in 1 volume of 50 mM cold Tris pH 8.0, 0.15 M NaCI. The buffer used with COMITROL ™ also contained 0.04% sodium metabisulfite. Following homogenization, the slurry of the crushed plant material was centrifuged at 5,000 g for 5 minutes at 4 ° C and the crude extracts (supernatant) preserved for analysis. The total protein content of the clarified crude extracts was determined by the Bradford assay (Bio-Rad, Hercules, CA) using bovine serum albumin as the reference standard. Extraction of VLP by cell wall digestion
[000134] The leaf tissue was collected from Nicotiana benthamiana plants and cut into pieces of ~ 1 cm2. The leaf parts were soaked in 500 mM mannitol for 30 minutes at room temperature (RT). The mannitol solution was then removed and modified with the enzyme mixture (the Tríchoderma viride cellulases mixture (Onozuka R-10; 3% v / v) and a mixture of Rhizopus sp. Pectinases (MACEROZYME ™; 0.75 % v / v; both from Yakult Pharmaceuticals) in protoplast solution (500 mM mannitol, 10 mM CaCL and 5 mM MES / KOH (pH 5.6)). The proportion used was 20 g of leaf parts per 100 mL of solution This preparation was also expanded in a shallow vessel (~ 11x18 cm) and incubated for 16 hours on a rotary shaker at 40 rpm and 26 ° C.
[000135] Alternatively, extraction of VLP can be performed as follows: the plants were agro-infiltrated with AGL1 / # 685 as described in example 1. Leaf tissue was collected from N. benthamiana plants on day 6 post-infiltration and cut in parts of ~ 1cm2. Multifect Pectinase FE, Multifect CX CG and Multifect CX B (Genencor) at 1.0% each (v / v) were added in 600 mM Mannitol buffer, 75 mM citrate, 0.04% sodium bisulfite pH 6, 0 using a 1: 2.5 (w / v) ratio of fresh biomass: digestion buffer. The biomass was digested for 15 h at room temperature on an orbital shaker.
[000136] Following the incubation, the leaf fragment was removed by filtration (250 or 400 pm nylon filter net). The protoplasts in the suspension were collected by centrifugation at 200 x g (15 min), followed by centrifugation of the supernatant at 5000 x g (15 min) to further clarify the supernatant. Alternatively, a single centrifugation step at 5000 x g for 15 minutes can be employed. Seventy ml of the supernatant was then centrifuged at 70,000 x g for 30 minutes. The resulting precipitate was resuspended in 1.7 ml of PBS and analyzed immediately or frozen. Protein Analysis
[000137] An hemoagglutination assay for H5 was based on a method described by Nayak and Reichl (2004). Briefly, double serial dilutions of the test samples (100 pL) were made in 96-well V-bottom microtiter plates containing 100 pL of PBS, leaving 100 pL of diluted sample per well. One hundred microliters of a 0.25% suspension of red turkey blood cells (Bio Link Inc, Syracuse, NY) was added to each well, and the plates were incubated for 2 h at room temperature. The reciprocal of the highest dilution showing complete haemagglutination was recorded as hemoagglutination activity. In parallel, a recombinant HA5 standard (A / Vietnam / 1203/2004 H5N1) (Protein Science Corporation, Meriden, CT) was diluted in PBS and used as a control on each plate. ELISA
[000138] The HA5 standard was prepared with purified virus-like particles that were disrupted by treatment with 1% Triton X-100 followed by mechanical stirring in a Tissue Lyser ™ (Qiagen) for 1 min. 96-well microtiter plates with U-bottom were coated with 10 pg / mL of capture antibody (Immune Technology Corporation, # IT-003-005l) in 50 mM bicarbonate - carbonate coating buffer (pH 9.6) for 16-18 hours at 4 ° C. All washes were performed with 0.01 M PBS (phosphate buffered saline), pH 7.4 containing 0.1% Tween-20. After incubation, the plates were washed three times and blocked with 1% casein in PBS for 1 hour at 37 ° C. After the blocking step, the plates were washed three times. The HA5 standard was diluted in a fake extract (prepared from the leaf tissue infiltrated with AGL1 / R472 alone) to generate a standard curve of 500 to 50 ng / mL. The samples to be quantified were treated with 1% Triton X-100 before loading onto the microplate. The plates were further incubated for 1 hour at 37 ° C. After washing, diluted 1: 1000 diluted HA5 (CBER / FDA) polyclonal antibody against sheep was added and the plates were incubated for 1 hour at 37 ° C. After washing, rabbit antibody conjugated to 1: 1000 diluted anti-sheep peroxity was added and the plates were incubated for 1 hour at 37 ° C. After the final washings, the plates were incubated with peroxidase substrate (KPL) SureBlue TMB for 20 minutes at room temperature. The reaction was stopped by the addition of 1N HCI and / Usage values were measured using a Multiskan Ascent plate reader (Thermo Scientific). Example 1: enzymatic extraction of high amounts of HA from plant tissue having a high relative activity.
[000139] The amount and relative activity of HA obtained from the enzymatic extraction method present were compared with that of HA obtained by common methods of mechanical extraction. N. benthamiana plants were infiltrated with AGL1 / 685 and the leaves were collected after an incubation period of five to six days. Leaf homogenates were prepared as follows: Two grams of leaves were homogenized with a Polytron homogenizer; 4g of leaves were macerated with a pistil and pestle; and 25 kg of leaves were homogenized with a COMITROLTM processor (Urschel Laboratories) in an extraction buffer (50 mM Tris, 150 mM NaCI pH 8.0, 1: 1 w / v ratio). The enzymatic extraction was performed as follows: Twenty grams of collected leaves were submitted to digestion with Macerozyme pectinases and Onozuka R-10 cellulases as described above. After digestion, the leaf fragments were removed by filtration (250 pm nylon filter net). The protoplasts in the suspension were removed by centrifugation at 200 x g (15 min), and the supernatant further clarified by centrifugation at 5000 x g (15 min).
[000140] The relative activity and the amount of HA in each of these plant extracts are shown in Table 3. The amount of HA released by enzymatic digestion of the cell wall is significantly higher when compared to other techniques used. Table 3: HA-VLP recovered from the plant extract generated by different mechanical or enzymatic methods. For activity-based and ELISA comparisons, data were normalized according to the relative volume of fresh biomass liquid extract. The protein obtained using Comitrol extraction was established at 100%, and other methods compared with this value.
* The quantity was evaluated with ELISA analysis Example 2: Enzymatic digestion of plant tissue releases HA organized into VLPs.
[000141] A combination of differential centrifugation and size exclusion chromatography (SEC) was used to demonstrate that HA obtained by the enzymatic extraction method described in this application was organized as VLPs. N. benthamiana plants were agro-infiltrated with AGL1 / 685 as described in Example 1. The leaves were collected from the plants 6 days post-infiltration and broken into ~ 1 cm2 parts then digested, coarsely filtered and centrifuged as described in Example 1.
[000142] The clarified samples were then centrifuged at 70,000 x g to allow segregation of VLPs. The centrifugation precipitate, containing the VLPs, was gently resuspended in a 1/50 volume of phosphate buffered saline (PBS; 0.1 M sodium phosphate, 0.15M NaCI pH 7.2) before being loaded onto a SEC column.
[000143] 32 ml SEC columns of SEPHACRYL ™ S-500 high resolution beads (S-500 HR: GE Healthcare, Uppsala, Sweden, Cat. No. 17-0613-10) were prepared with the balance buffer / elution (50 mM Tris, 150 mM NaCl, pH 8). SEC chromatography was performed by loading 1.5 ml of a VLP sample into the balanced column, and eluting it with 45 ml of the equilibration / elution buffer. The eluate was collected in 1.7 ml fractions, and the protein content of each fraction was evaluated by mixing 10 pL of the eluate fraction with 200 pL of diluted Bio-Rad protein dye reagent (Bio-Rad, Hercules, HERE). Each separation was preceded by a calibration with Dextran Blue 2000 (GE Healthcare Bio-Science Corporation, Piscataway, NJ, USA). The comparison of the elution profiles of both Dextran Blue 2000 and host proteins was performed for each separation to ensure uniformity of the separations. Protein analysis of fractions eluted by SEC
[000144] The total protein content of the clarified crude extracts was determined by the Bradford assay (Bio-Rad, Hercules, CA) using bovine serum albumin as the reference standard. The proteins present in the fractions of the SEC eluate were precipitated with acetone (Bollag et al., 1996), resuspended in either 0.25 volume or 0.05 volume of sample loading denaturing buffer (0.1M Tris pH 6, 8, 0.05% glycerol, 12.5%, bromophenol blue, 4% SDS and 5% beta-mercaptoethanol) for analysis by SDS-PAGE or immunostaining, respectively. Separation by SDS-PAGE was carried out under reduction conditions, and Coomassie Brillant Blue R-250 was used for protein labeling.
[000145] The hemoagglutination assay for H5 was performed based on a method described by Nayak and Reichl (2004). Briefly, successive double dilutions of the test samples (100 pL) were made in 96-well V-bottom microtiter plates containing 100 pL of PBS, leaving 100 pL of diluted sample per well. One hundred microliters of a 0.25% suspension of red turkey blood cells (Bio Link Inc, Syracuse, NY) was added to each well, and the plates were incubated for 2 h at room temperature. The reciprocal of the highest dilution showing complete haemagglutination was recorded as hemoagglutination activity. In parallel, a recombinant HA5 standard (A / Vietnam / 1203/2004 H5N1) (Protein Science Corporation, Meriden, CT) was diluted in PBS and used as a control on each plate.
[000146] Figure 3A shows that the hemoagglutination activity is concentrated in the fractions corresponding to the null volume of the column, confirming that the hemoagglutination activity originates from a structural organization of high molecular weight. Analysis by SDS-PAGE (Figure 3B) revealed that those same zero volume fractions (fractions 7-10) also have the highest HA content, with a band corresponding to the HA0 monomer being detectable at approximately 75 kDa. Example 3: Enzymatic digestion of plant tissue releases HA-VLPS with less contaminants
[000147] The / V plants. benthamiana were agro-infiltrated with AGL1 / 685 as described in Example 1. The leaves were collected on day 6 post-infiltration, cut into ~ 1 cm2 parts, digested, coarsely filtered and centrifuged as described in Example 1.
[000148] The controlled enzymatic digestion of the leaves removed the cell walls, at least partially, thus allowing the release of proteins and components present in the space between the cell wall and the plasma membrane in the extraction medium. Since most proteins and intracellular components were still undamaged and contained within the majority of intact protoplasts, an initial centrifugation step allowed for their removal, thereby providing a resulting solution that comprises cell wall degrading enzymes, in addition to proteins and extracellular plant components (apoplastic fraction), as shown in Figure 4.
[000149] Figure 4 shows an SDS-PAGE analysis of the resulting solution obtained after controlled enzymatic digestion of the leaf tissue as described previously, with line 1 showing the enzyme mixture used and line 2 showing the resulting solution after enzymatic digestion. The protein content of a crude Comitrol ™ extract is provided in line 3 for comparison. The biomass: buffer ratio for the extract presented in line 2 was 1: 5 (w / v) while it was 1: 1 (w / v) for that in line 3. Each of lines 2 and 3 therefore contains proteins derived from a equivalent amount of starting material. For approximately the same buffer: plant ratio, a mechanical plant extract contained a protein concentration of approximately 3.5-4 mg / ml, while the enzymatic plant extract obtained according to the present method showed a protein concentration of approximately 1 mg / ml. ml.
[000150] The main contaminant present in line 3 was found to be RubisCo (Ribulose-1,5-bisphosphate and carboxylase oxygenase), which is made up of two types of protein subunits: the large chain (L, approximately 55 kDa) and the small chain (S, approximately 13 kDa). A total of eight large-chain dimers and eight small-chains typically merge with each other in a RubisCo complex larger than 540 kDa. While this vegetable protein contaminant is found in large quantities in plant extracts that originate from the mechanical extraction method (see the arrow in Figure 4), it is virtually absent in plant extracts obtained by the enzymatic digestion method described in this application. Therefore, the present method allows the elimination of this main vegetable protein contaminant, among others, at an early stage of the process. Example 4: Enzymatic digestion of plant tissue releases HA-VLP under conditions where it can be directly captured in a cation exchange resin.
[000151] The plants / V. benthamiana were agro-infiltrated with AGL1 / 685 as described in Example 1. Leaves were collected on day 6 post-infiltration, cut into ~ 1 cm2 parts and digested for 15 h at room temperature on an orbital shaker. The digestion buffer contained 1.0% (v / v) Multifect Pectinase FE, 1.0% (v / v) Multifect CX CG orand, 1.0% (v / v) Multifect CX B (all from Genencor), each in a 600 mM Mannitol buffer solution, 75 mM Citrate, 0.04% sodium bisulfite pH 6.0 using a 1: 2.5 (w / v) ratio of biomass: digestion buffer .
[000152] After digestion, the apoplastic fraction was filtered through a 400 pm nylon filter to remove coarse undigested plant tissue (<5% of the initial biomass). The filtered extract was then centrifuged at room temperature for 15 min at 5000 x g to remove protoplasts and intracellular contaminants (proteins, DNA, membranes, vesicles, pigments, etc.). Then, the supernatant was filtered through depth (for clarification) using a 0.65 pm glass fiber filter (Sartopore2 / Sartorius Stedim) and a 0.45 / 0.2 pm filter before being subjected to chromatography. .
[000153] The clarified apoplastic fraction was loaded above a cation exchange column (Poros HS Applied Biosystems) equilibrated with an equilibration / elution buffer (50 mM NaPO4, 100 mM NaCI, 0.005% Tween 80 pH 6, 0). Once UV was back to zero, the extract was eluted with the equilibration / elution buffer containing increasing concentrations of NaCI (500 mM). Where necessary, the chromatographic fractions were concentrated 10 times using Amicon ™ devices equipped with MWCO 10 kDa. Protein analysis was performed as described in the previous examples.
[000154] Under the above conditions, most plant enzymes and proteins did not bind to the cation exchange resin whereas HA-VLP did, thereby providing considerable enrichment of HA-VLPS in the eluted fraction (Figure 6). In addition, as shown in Figure 6, lines 4 and 5, cellulases and pectinases did not bind to the cation exchange column at pH below 7. Consequently, the recovery of HA-VLP, based on the hemagglutination activity of HA, it was 92% before loading in the cation exchange column, and 66% in the eluted fraction. A purification factor of 194 was measured in the fraction eluted from the cation exchange resin. Example 5: Adding NaCI to the digestion buffer
[000155] The A /, benthamiana plants were agro-infiltrated with strains of AgrobacteriumAGL1 that carry a construct that expresses a hemagglutinin of interest (H1 / Cal WT, B / Flo, H5 / lndo or H1 / Cal X179A) as described in Example 1 The leaves were collected on day 6 post-infiltration, cut into ~ 1 cm2 parts and digested according to Example 4, except where noted below. Filtration, centrifugation and clarification were carried out as described in Example 4.
[000156] NaCI was added to the digestion buffer to assess its potential effect on the recovery rate of HA-VLP. The suspected advantages were the potential prevention of the non-specific association of HA with plant cells or particles in the suspension that are removed during clarification and the potential effect on obtaining and / or maintaining and / or improving the colloidal stability of HA-VLP.
[000157] The addition of 500 mM NaCI to the digestion buffer resulted in an increase in the recovery yield of HA-VLP per gram of biomass after the removal of protoplasts and cell fragments by centrifugation. However, this increase was only observed with and for the H1 / Cal WT and B / Flo strains, while the H5 recovery yield was not significantly increased by this approach (Table 4). Table 4: Effect of adding NaCI on the digestion stage on HA-VLP recovery yield (as measured by the hemagglutination activity unit, dil: reciprocal of dilution)

1 Yield (dil / g) with NaCI divided by Yield (dil / g) without NaCI
[000158] The addition of 500 mM NaCI during digestion still resulted in an increased release of HA-VLP during digestion, which in turn resulted in an increase in the recovery rate after clarification for both H1 / Cal WT strains and H1 / Cal X-179A (Table 5), but not for the H5 / lndo strain. Table 5: Effect of adding NaCI in the digestion stage on the HA-VLP recovery yield (as measured by the hemagglutination activity unit) after the clarification stage.

The recovery is expressed in the percentage of the hemoagglutination activity obtained after depth filtration compared to the activity found in the centrifuged digested extract.
[000159] The association status of HA-VLP, with and without the addition of NaCI during enzymatic digestion, was studied using Nanoparticle Tracking Analysis (NTA) for H5 / lndo and H1 / Cal WT (Figure 7A and 7B respectively ). A monodispersed preparation of particles was observed for H5 when digestion was carried out in the absence of NaCI, while the preparation H1 / Cal showed a much larger array of particle species. The addition of NaCI to the digestion buffer reduced the auto-association of HA-VLP to H1 / Cal, as shown by the regularly monodisperse particle distribution found in Figure 7C. The number of particles in 150 nm H1 / Cal WT-VLPs was increased (approximately 5 times) by adding 500 mM NaCI to the digestion buffer. Example 6: Pigment release control
[000160] The A /, benthamiana plants were agro-infiltrated with strains of AgrobacteriumAGL1 that carry a construct that expresses a hemagglutinin of interest (H5 / lndo) as described in Example 1. The leaves were collected on day 6 post-infiltration, cut into ~ 1 cm2 parts and digested according to Example 4, with the addition of 500 mM NaCI or 500 mM NaCI and 25 mM EDTA to the digestion buffer. Filtration, centrifugation and clarification were carried out as described in Example 4.
[000161] The release of components that have a green color during the enzymatic digestion stage led to the purified preparation of the VLP that has a greenish color. The composition of the cell wall digestion solution was therefore investigated and adjusted to obtain a purified VLP preparation that has a reduced green color, and thus an increased purity. Without wishing to be bound by theory, since Ca2 + plays a critical role in retaining constituents of the lamella in the middle of the cell wall together, and since there is normally a high concentration of Ca2 + in the plant cell wall, adding the chelator Ca2 + EDTA can facilitate enzymatic depolymerization of the cell wall, thereby preserving intact intracellular organelles, such as chloroplasts, and preventing the release of green pigment components.
[000162] As shown in Table 6, the addition of 25 mM EDTA to the digestion buffer allowed the reduction of the green coloration of the purified H5-VLP preparation, as assessed by measuring the difference in the absorption of the preparation (OD672nm - ODesonm). When green constituents were released in large quantities, or not properly removed, the VLP preparation exhibited an ΔOD> 0.040. Table 6: Effect of adding 25 mM EDTA to the digestion buffer on the green color of H5-VLP preparations.
Example 7: Alternative digestion buffer compositions
[000163] N. benthamiana plants were agro-infiltrated with strains of AgrobacteriumAGL1 that carry a construct that expresses a hemagglutinin of interest (H5 / lndo) as described in Example 1. The leaves were collected on day 6 post-infiltration, cut into parts ~ 1 cm2 and digested according to Example 4, with modification of the digestion buffer to include 0%, 0.25%, 0.5%, 0.75% or 1% v / v Multifect Pectinase FE, Multifect CX-CG cellulase and Multifect CX B cellulase as seen in Tables 7-9. Filtration, centrifugation and clarification were as described in Example 4.
[000164] As shown in the following tables 7 and 8, pectinase has been shown to be expendable in the digestion buffer. Similar levels of H5 / lndo or H1 / Cal WT VLP can be extracted with the present method in the presence or absence of pectinase. In addition, it was found that reducing cellulase concentration when compared to previous examples had no significant impact on the quality of extraction (Table 9). Table 7: H5 / lndo VLP release by digestion of / V leaves. benthamian. All conditions were tested in replicate. (HA-VLP concentration measured by hemagglutination activity, dil: reciprocal of dilution)
'Multifect CX GC Table 8: H1 / Cal WT VLP release by digestion of N. benthamiana leaves. All conditions were tested in replicate. (HA-VLP concentration measured by hemagglutination activity, dil: reciprocal of dilution)
* 1% of each Multifect CX GC and Multifect CX B Table 9: H1 / Cal WT VLP release by digestion of A / sheets. benthamian. All conditions were tested in replicate. (HA-VLP concentration measured by hemagglutination activity, dil: reciprocal of dilution)
'Multifect CX GC Example 8: Enzymatic digestion under conditions close to neutral pH
[000165] The control of pH during digestion can be critical for the extraction of some VLPs. Considering that the depolymerization of the cell wall that occurs during the digestion stage can release sugar acids that can acidify the solution (ie pH 6 to 5) in the presence of appropriate buffers, and that some VLPs (such as those comprising H3 / Bris and B / Flo HA) have already demonstrated a strong sensitivity to mildly acidic conditions, the impact of such potential acidification on the yield of the produced VLP has been investigated.
[000166] N. benthamiana plants were agro-infiltrated with strains of AgrobacteriumAGL1 that carry a construct that expresses a hemagglutinin of interest (B / Flo, H5 / lndo H3 / Bris) as described in Example 1. The leaves were collected on day 6 post - infiltration, cut into ~ 1 cm2 parts and digested according to Example 4, with modification of digestion conditions to include 500 mM NaCI; 25 or 50 mM EDTA; 0.03 or 0.04% sodium bisulfite; 0, 100, 200 or 600 mM mannitol, 75, 125 or 150 mM citrate; e / uu 75 mM d NaPθ4j with the pH of the digestion buffer adjusted as set out in Tables 10-14. Filtration, centrifugation and clarification were as described in Example 4.
[000167] Various digestion buffer compositions were tested to reach a pH of approximately 5.5 by the end of enzymatic digestion, including increased citrate concentration (buffer effect between pH 3.0 and 5.4) and addition of sodium phosphate (buffer effect at pH above 6.0). Table 10 shows that the B strain VLPs were extracted more efficiently when the post-digestion pH was close to pH 6.0. Table 10: Effect of the digestion buffer composition on the extraction yield of B / Flo VLPs.
All buffers contained 600 mM mannitol, 0.04% sodium metabisulfite
[000168] Then, the effect of starting digestion at a higher pH in order to reach the final pH value close to pH 6.0 was tested. As shown in Table 11, digestion of the plant cell wall with such conditions close to neutral was possible, and did not impair the yield of Hõ / lndo VLPs extraction. Table 11: Effect of the initial pH of the digestion buffer on the extraction yield of Hõ / lndo VLPs.
All buffers contained 600 mM mannitol, 0.04% sodium metabisulfite, 125 mM Citrate + 75 mM NaPÜ4 + 500 mM NaCI + 25 mM EDTA
[000169] Other components of the digestion solution have also been shown to be modifiable without adversely affecting the extraction yield of VLPs. Table 12 illustrates modifications that can be applied to the digestion solution in order to increase the extraction yield of B / Flo VLPs, while obtaining a post-digestion pH of 5.4 - 5.7. Such modifications include increasing the citrate concentration and adding PO4 buffer. It has been found that increasing the concentration of EDTA generally led to a more acidified extract and lower yields of VLP extraction. Table 12: Effect of various components of digestion buffer on the extraction yield of B / Flo VLPs.
1All buffers contained 500 mM mannitol, 0.04% sodium metabisulfite.
[000170] The buffer composition was further modified to improve the extraction yield of H3 / Brisbane VLPs (Table 13) Table 13: Effect of concentrations of mannitol and sodium bisulfite on the digestion solution on the extraction yield of H3 VLPs / Bris.
1All buffers contained 125 mM Citrate, 75 mM NaPO4, 500 mM NaCI
[000171] As shown in Tables 12 and 13, the mannitol concentration can be reduced to 200 mM without significantly affecting the extraction yield of VLPs. The further reduction in mannitol concentrations to 100 mM, and even the total omission of mannitol from the digestion solution, did not significantly affect the level of HA-VLP obtained (Table 14). Table 14: VLP of H5 / lndo released from digestion of biomass carried out in buffers with different concentration of mannitol.
1All buffers contained 75 mM Citrate pH 6.0 + 0.04% sodium metabisulfite. 2Two tests were performed to compare the extraction yields of VLPs without mannitol (Test 1) and with 100 mM mannitol (Test 2) against 600 mM mannitol. Example 9: Suitability of enzyme digestion to a wide variety of HA-VLPs
[000172] The enzymatic digestion method for plant biomass described in this application has the potential to be applied to the extraction of a wide variety of HA-VLPS. Adding to the extraction of HAVLPS comprising H5 / Indo, H1 / Cal WT VLP, H3 / Bris and B / Flo shown in the previous examples, it was also shown that the method described in this application was suitable for the extraction of HA-VLPs from H1 / Seasonal Bris and H1 / NC, as shown in Table 15. Table 15: Release of seasonal Hl / Bris and H1 / NC from digestion of agro-infiltrated N. benthamiana leaves. (HA concentration measured by hemagglutination activity, dil: reciprocal of dilution)
Example 10: preparation of antibody expression and analysis
[000173] The C2B8 expression cassette meeting (construct # 595)
[000174] C2B8 is a chimeric monoclonal antibody (mouse / human) directed against the B cell specific CD20 antigen expressed in non-Hodgkin's lymphomas (NHL). C2B8 mediates complement and cell-mediated antibody-dependent cytotoxicity and has direct antiproliferative effects against malignant B cell lines in vitro (N Selenko et. Al., Leukemia, October 2001, 15 (10); 1619-1626).
[000175] A DNA fragment comprising 84 bp of the alfalfa plastocyanin promoter, the complete C2B8 light chain coding sequence and the complete alfalfa plastocyanin terminator has been synthesized (LC fragment). The LC fragment was flanked by a Dralll restriction site (found in the plastocyanin promoter) and an EcoRI site downstream of the plastocyanin terminator. The sequence of the LC fragment is shown in Figure 9 (SEQ ID NO: 15). The plasmid containing the LC fragment was digested with Drain and EcoRI and cloned in construct # 660 (D’Aoust et al., Plant Biotechnol. J. 2008, 6: 930-940), previously digested with the same enzymes. The resulting plasmid was called construct number 590. A second DNA fragment was synthesized comprising 84 bp of the alfalfa plastocyanin promoter, the complete C2B8 light chain coding sequence and the complete alfalfa plastocyanin terminator (HC fragment). The HC fragment was flanked by a Dralll restriction site (found in the plastocyanin promoter) and an EcoRI site downstream of the plastocyanin terminator. The sequence of the HC fragment is shown in Figure 9 (SEQ ID NO: 15). The plasmid containing the HC fragment was digested with Dralll and EcoRI and cloned in construct # 660 (D’Aoust et al., Plant Biotechnol. J. 2008, 6: 930-940), previously digested with the same enzymes. The resulting plasmid was called construct number 592. The A. tumefacians strain, comprising 592, is called "AGL1 / 592".
[000176] The plasmid comprising a dual expression cassette for C2B8 expression (construct # 595) was pooled as follows. Construct number 592 was digested with EcoRI, treated with the Klenow fragment to generate broken ends and digested with Sbfl. The resulting fragments, comprising the complete C2B8 heavy chain expression cassette flanked by a Sbfl site and a broken end, were inserted into construct # 590 previously digested with Sbfl and Smal. Figure 11A shows a schematic representation of construct # 595 used for the expression of C2B8 in plants.
[000177] The P19 expression cassette meeting (construct # R472)
[000178] The R472 construct, which encodes the p19 protein is described above ("Silencing suppressors"; see Figure 11B)
[000179] Preparation of vegetable biomass, bacterial inoculum, agro-infiltration, and harvest
[000180] Nicotiana benthamiana plants were grown as described above ("Preparation of plant biomass, inoculum, agro-infiltration, and harvest") in the greenhouse under a photoperiod of 16/8 and a temperature regime of 25 ° C during the day and 20 ° C overnight. Three weeks after planting, individual seedlings were chosen, transplanted into pots and left to grow in the greenhouse for an additional three weeks under the same environmental conditions.
[000181] Agrobacteriaque carrying construct # 595 or # R472 were grown in LB BBL select APS broth medium supplemented with 10 mM 2- [N-morpholino] ethanesulfonic acid (MES), 50 pg / ml kanamycin and 25 pg / ml carbenicillin pH5.6 until they reach an ODeoo> 2.0. The Agrobacterium suspensions were centrifuged before use and resuspended in the infiltration medium (10 mM MgCh and 10 mM MES pH 5.6) and stored overnight at 4 ° C. On the day of infiltration, the culture batches were diluted in 6.7 culture volumes and heated before use. The whole plants of N. benthamiana were placed inverted in the bacterial suspension in an airtight stainless steel tank under a vacuum of 20-40 Torr for 1 min. After infiltration, the plants were returned to the greenhouse during an incubation period of 5 days until harvest. Infiltrations were performed as co-infiltration with strains AGL1 / 595 and AGL1 / R472 in a 1: 1 ratio.
[000182] Leaf sampling and total protein extraction (mechanical extraction)
[000183] After incubation, the aerial part of the plants was collected and used immediately. The total soluble proteins were extracted by homogenizing vegetable tissue in a domestic blender for 3 min. with 1.5 volumes of 20 mM NaPCUfrio pH 6.0, 0.15 M NaCI and 2 mM sodium metabisulfite. After homogenization, the slurry of the crushed plant material was filtered through Miracloth to remove large insoluble fragments. The pH of the extract was adjusted to 4.8 by the addition of 1M HCI and the non-soluble materials were removed by centrifugation 18000 g for 15 min (4 ° C). The supernatant was collected and the pH was adjusted to 8.0 with 2 M of Tris base. Insoluble materials were removed by centrifugation at 18000 g for 15 minutes at 40 ° C and the crude extract (supernatant) was collected. The total protein content of the clarified crude extracts was determined by the Bradford assay (Bio-Rad, Hercules, CA) using bovine serum albumin as the reference standard.
[000184] Protein extraction by cell wall digestion
[000185] The leaf tissue was collected from Nicotiana benthamiana plants and cut into pieces of ~ 1 cm2. The leaf pieces were placed in 2.425 volumes of the digestion solution (75 mM citrate pH 6.9, 600 mM mannitol, 1% Multifect Pectinase FE, 1% Multifect CXG, 1% Multifect B). This preparation was also expanded in a shallow vessel and incubated for 16 hours on an orbital shaker at 120 rpm and 18 ° C. After incubation, the leaf fragments were removed by filtration through a nylon filter (250 pm mesh). The extract was centrifuged at 5000 g for 15 min. (22 ° C) and the supernatant was collected and filtered on 0.65 pm glass fiber. The extract was adjusted to pH 6.0 with 0.5 M Tris base and filtered through the PES 0.45 / 0.22 pm membrane.
[000186] Ammonium sulphate precipitation and antibody purification
[000187] Ammonium sulfate was slowly added to protein extracts to achieve 45% saturation. The extract was kept on ice for 60 min and centrifuged at 18000 g for 20 min. (4 ° C). The supernatant was discarded and the precipitate was kept frozen (- 80 ° C) until use.
[000188] The frozen protein precipitate was thawed and resuspended 1/10 volume (compared to the volume prior to precipitation) of the protein resuspension solution (50 mM Tris pH 7.4, 150 mM NaCI). The protein solution was centrifuged at 12000 g for 20 min. (4 ° C) to remove non-solubilized materials. The protein solution was loaded onto the MabSelect Sure resin (GE Healthcare, Baie d’Urfé, Canada). The column was washed with 10 CV of 50 mM Tris pH 7.4, 150 mM NaCI and the antibody was eluted with 6 CV of 100 mM sodium citrate pH 3.0. The elution volume was collected in CV fractions in tubes containing 1/10 CV of 2 M Tris pH 7.4, 150 mM NaCI. The elution fractions were selected based on their protein content (measured by Bradford) and the selected fractions were grouped and kept frozen (-80 ° C) before analysis.
[000189] Protein quantification and analysis by SDS-PAGE
[000190] Total protein content was determined by the Bradford assay (Bio-Rad, Hercules, CA) using either bovine serum albumin (for crude protein extracts) or commercial rituximab (Rituxan ®, Hoffmann-La Roche, Mississauga, Canada) ( for purified antibodies) as the reference standard. Coomassie-labeled SDS-PAGE was performed as described by Laemmli (Nature 1970, 227: 680-685).
[000191] Quantification of C2B8 by ELISA
[000192] Multi-well plates (Immulon 2HB, ThermoLab Systmes, Franklin, MA) were coated with 2.0 pg / ml of anti-human mouse monoclonal IgG (Abeam, Ab9243) in 50 mM carbonate buffer (pH 9.6 ) at 4 ° C for 16 - 18h. The multi-well plates were then blocked with a 1 h incubation with 1% casein in phosphate buffered saline (PBS) (Pierce Biotechnology, Rockford, II) at 37 ° C. A standard curve was generated with dilutions of Rituximab (Rituxan ®, Hoffmann-La Roche, Mississauga, Canada). Performing immunoassays, all dilutions (control and samples) were performed in a plant extract obtained from infiltrated plant tissue and incubated with a false inoculum (AGL1 / R472 only) to eliminate the matrix effect. The plates were incubated with protein samples and dilutions of the standard curve for 1 h at 37 0 C. After three runs with 0.1% Tween-20 in PBS (PBS-T), the plates were incubated with an anti-dunkey IgG antibody. peroxidase-conjugated human (1/4000 dilution in blocking solution) (Jackson ImmunoResearch 709-035-149) for 1 h at 37 0 C. The washes with PBS-T were repeated and the plates were incubated with a peroxidase 3 substrate, 3 ', 5.5' -Tetramethylbenzidine (TMB) Sure Blue (KPL, Gaithersburg, MD). The reaction was stopped by adding 1N HCI and the absorbance was read at 450 nm. Each sample was analyzed in triplicate and the concentrations were interpolated on the linear portion of the standard curve.
[000193] Analysis by N-glycan
[000194] Samples comprising C2B8 (Rituxan ™; 50 pg) were separated on 15% SDS / PAGE. Heavy and light chains were developed with Coomassie blue and the protein band corresponding to the heavy chain was excised and cut into small fragments. The fragments were washed 3 times with 600 µl of a 0.1 M solution of NH4HCO3 / CH3CN (1/1) for 15 minutes each and dried.
[000195] The reduction of disulfide bridges occurred by incubating the gel fragments in 600 pL of a solution of 0.1 M DTT in 0.1 M NH4HCO3, at 56 ° C for 45 minutes. Alkylation was carried out by adding 600 µl of a 55 mM iodoacetamide solution in 0.1 M NH4HCO3, at room temperature for 30 minutes. The supernatants were discarded and the polyacrylamide fragments were washed once more in 0.1 M NH4HCO3 / CH3CN (1/1).
[000196] The proteins were then digested with 7.5 pg of trypsin (Promega) in 600 pL of 0.05 M NH4HCO3, at 37 ° C for 16 h. Two hundred pL of CH3CN was added and the supernatant was collected. The gel fragments were then washed with 200 µL of 0.1 M NH4HCO3, then with 200 µL of CH3CN again and finally with 200 µL of 5% formic acid. All supernatants were pooled and lyophilized.
[000197] The glycopeptides were separated from the peptides by chromatography on a Sep-Pack C18 cartridge. The glycopeptides were specifically eluted with 10% CH3CN in water and then analyzed by MALDI-TOF-MS in a Voyager DE-Pro MALDI-TOF (Applied Biosystems, USA) equipped with a 337 nm nitrogen laser beam. Mass spectra were performed in the delayed reflector extraction mode using dihydrobenzoic acid (Sigma-Aldrich) as a matrix. Example 11: Comparison of extraction yields for C2B8 antibody
[000198] Enzymatic digestion was compared with mechanical extraction for the extraction of the C2B8 antibody. N. benthamiana plants were agro-infiltrated with AGL1 / 595 and AGL1 / R472. After 6 days of incubation, the leaves were collected and the proteins were extracted by enzymatic digestion or mechanical extraction. The extractions were performed twice and the resulting extracts were compared by volume, protein concentration and antibody content (C2B8). The results are shown in Table 16. Table 16: Comparison of extraction yield by mechanical rupture (blender extraction) and enzymatic digestion of cell walls.

[000199] From 700 g of biomass, mechanical extraction generated an average of 1440 ml of protein extract while digestion generated 2285 ml of protein extract. The percentage of C2B8 antibody was higher in the digestion extract (average value of 479% of extracted proteins) than in the extract produced in the blender (average value of 3.49% of extracted protein). Taken together, the greater volume of the extract and the higher concentration of the antibody found in the extract results in a 37% higher extraction yield of digestion (240.75 mg C2B8 / kg fresh weight) than mechanical extraction (175, 95 mg C2B8 / kg fresh weight). Example 13: Comparison of the purified C2B8 antibody (protein content)
[000200] The C2B8 antibody was purified from the extracts by protein A affinity chromatography as described in Example 10. The purified products of extracts obtained by mechanical extraction or digestion were compared based on their protein content. The electrophoretic profile of the purified antibodies for each extraction batch is shown in Figure 12. The results show that the profiles of the purified products from extraction with blender or cell wall digestion are similar. Example 14: Comparison of the purified C2B8 antibody (N-glycosylation)
[000201] Protein N-glycosylation consists of adding a glycan complex to the asparagine structure of secreted proteins that carry the NXS / T sequence, where N is asparagine, X is any amino acid except a proline and S / T is a serine or a threonine. A glycan precursor is added early in the endoplasmic reticulum during the translation of the protein and, during its transit through the secretion pathway, N-glycans are subject to maturation. Of the type of N-glycan with high rate of mannose in the endoplasmic reticulum (ER), the maturation of N-glycans in plants includes the addition and removal of glucose residues, the removal of mannose in distal positions and the addition of N-acetylglucosamine, xylose, fucose and galactose. The maturation of N-glycans in plants is described by Gomord. in the Post-translational modification of therapeutic proteins in plants (Curr. Opin. Plant Biol. 2004, 7: 171-181). The enzymes of the N-glycosylation pathway are positioned in precise locations in each compartment of the secretion pathway, read the endoplasmic reticulum, the cis-Golgi, the medial Golgi and the trans-Golgi. Therefore, the N-glycosylation model of a protein will differ depending on its position at the time of extraction. We noted earlier that a certain proportion of an antibody produced using agroinfiltration of / V. benthamiana carried immature N-glycans with a high rate of mannose despite being targeted by the apoplast (Vézina et al., Plant Biotechnol. J. 2009 7: 442-455). A similar observation has been reported elsewhere (Sriraman et al., Plant Biotechnol. J. 2004, 2, 279-287). In both cases, the presence of immature N-glycans in a certain proportion of antibodies was interpreted as the consequence of the presence of antibodies in early compartments of the secretion pathway at the time of extraction.
[000202] The following study examined whether the extraction of glycoproteins secreted by digestion of the cell wall preferentially extracted recombinant proteins carrying the N-glycan complex. Antibodies and other glycoproteins secreted in the apoplast are expected to carry N-glycans having completed their maturation. Mature N-glycans most commonly carry terminal N-acetiglucosamine or galactose residues and are also called N-glycans complexes. In contrast, immature N-glycans, most often found in proteins in the pathway of the secretory pathway, comprise terminal mannose residues. The high mannose content of N-glycans in C2B8 (Rituxan ™) has been associated with reduced half-life in the bloodstream (Kanda et al., Glycobiology 2006, 17: 104-118). In this context, an extraction method capable of favoring the extraction of apoplastic glycoproteins that carry complex N-glycans from plants would be desirable.
[000203] A comparative analysis of N-glycosylation in purified C2B8 antibodies was performed as described in Example 10. The results demonstrate that the purified antibodies from digested biomass carried a significantly lower proportion of oligomanosidic N-glycans (Figure 13A) and, as a corollary, a significantly higher proportion of N-glycan complexes (Figure 13B).
[000204] Digestive extraction of the cell wall can also be applied to plants that coexpress a glycoprotein and one or more enzymes to modify the N-glycosylation profile as described in WO 20008/151440 (Modifying glycoprotein production in plants', which is incorporated in this application by reference) to favor the recovery of glycoproteins that carry modified mature N-glycans. For example, mature N-glycans can be reduced, or free of xylose and fucose residues.
[000205] The method for modifying N-glycosylation may involve the co-expression of the protein of interest along with a nucleotide sequence encoding beta-1,4galactosyltransferase (GaIT; provided as SEQ ID NO: 14 of WO 20008/151440) , for example, but not limited to mammalian GaIT, or human GaIT however GaIT from other sources can also be used. The catalytic domain of GaIT (for example, nucleotides 370 - 1194 of SEQ ID NO: 14 as described in WO 20008/151440), can also be fused to a CTS domain of N-acetylglucosamine transferase (GNT1; for example, comprising 34- 87 nucleotides of SEQ ID NO: 17 according to WO 20008/151440), to produce a hybrid enzyme GNT1-GalT. The hybrid enzyme can be co-expressed with a sequence that encodes the protein with the superstructure of interest. In addition, the sequence encoding the superstructure of interest can be co-expressed with a nucleotide sequence encoding N-acetylglucosaminyltransferase III (GnT-11; SEQ ID NO: 16 as described in WO 20008/151440). A mammalian GnT-lll or human GnT-lll, GnT-lll from other sources can also be used. In addition, a hybrid enzyme GNT1-GnT-lll (SEQ ID NO: 26; as described in WO 20008/151440), comprising the CTS of GNT1 fused to GnT-lll can also be used.
[000206] All citations are incorporated in this application by reference, as if each individual publication was specifically and individually indicated to be incorporated by reference in this application and as if it were fully presented in this application. The citation of references in this application should not be interpreted or taken as an admission that such references are prior techniques to the present invention.
[000207] One or more currently preferred embodiments of the invention have been described by way of example. The invention includes all modalities, modifications and variations substantially in this application described above and with reference to the examples and figures. It will be apparent to persons skilled in the art that a number of variations and modifications can be made without departing from the scope of the invention as defined in the claims. Examples of such modifications include the replacement of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way.

权利要求:
Claims (32)
[0001]
1. Method for the preparation of proteins derived from plants, or suprastructure proteins, characterized by the fact that it comprises: (a) obtaining of a plant material or plant comprising proteins located in the apoplast, or suprastructure proteins, in which the plant material consists in leaves, pieces of leaves, frayed leaves or a combination thereof, (b) production of a fraction of protoplasts / spheroplasts and a fraction of apoplasts by treating the plant or plant matter with a mixture of enzymes that degrade the cell wall, comprising at least one cellulase and at least one pectinase, 50 mM to 750 mM of a salt and a buffer or buffer system that maintains the pH in the range of 5 to 6.6, at room temperature; and, (c) recovery of the apoplast fraction, the apoplast fraction comprising plant-derived proteins, or superstructure proteins, in which the superstructure proteins have a molecular weight of 75 to 1500 kDa.
[0002]
Method according to claim 1, characterized in that the mixture of enzymes that degrade the cell wall further comprises an osmotic.
[0003]
Method according to claim 1, characterized in that the mixture of enzymes that degrades the cell wall consists of at least one cellulase and at least one pectinase.
[0004]
4. Method according to claim 1, characterized by the fact that in the production step (step a), the plant is transformed with a nucleic acid that comprises a nucleotide sequence that encodes proteins, or suprastructure proteins, is selected from among a group of a peptide, a protein, a protein rosette, a protein complex, a proteasome, a metabolon, a transcription complex, a recombination complex, a photosynthetic complex, a membrane transport complex, a nuclear pore complex, a protein nanoparticle, a glycoprotein, an antibody, a polyclonal antibody, a monoclonal antibody, a single chain monoclonal antibody, a virus-like particle, a viral envelope protein, a viral structural protein, a viral capsid protein, a protein viral envelope, a chimeric protein, a chimeric protein complex, a chimeric protein nanoparticle, a chimeric glycoprotein, a chimeric antibody, a chimeric monoclonal antibody, a chimeric single chain monoclonal antibody, a chimeric hemagglutinin, and the plant or plant material is collected.
[0005]
Method according to claim 4, characterized in that the nucleic acid is introduced into the plant or plant matter in a transient manner.
[0006]
6. Method according to claim 4, characterized in that the nucleic acid is stably integrated into the genome of the plant or plant matter.
[0007]
7. Method according to claim 1, characterized by the fact that in the production stage (stage a), the plant or plant material is cultivated and the plant material or plant is collected.
[0008]
Method according to claim 4, characterized in that the nucleic acid comprises a nucleotide sequence that encodes a monoclonal antibody or an influenza hemagglutinin.
[0009]
Method according to claim 1, characterized in that the proteins derived from the plant, or suprastructure proteins, comprise protein components of influenza and the protein components of influenza consist of protein components of HA.
[0010]
10. Method according to claim 1, characterized by the fact that it also comprises a step of (d) purification of plant derived proteins, or superstructure proteins, from the apoplast fraction.
[0011]
11. Method according to claim 10, characterized in that the purification step comprises filtration of the apoplast fraction using depth filtration to produce a clarified extract, followed by chromatography of the clarified extract using size exclusion chromatography, resin cation exchange or affinity chromatography, or a combination thereof.
[0012]
12. Method for preparing plant-derived proteins, or suprastructure proteins, characterized by the fact that it comprises: (a) obtaining a plant material or plant comprising proteins derived from plant or suprastructure proteins, in which the plant material consists of leaves, pieces of leaves, shredded leaves or a combination thereof, (b) digestion of plant matter or plant using a mixture of enzymes that degrades the cell wall comprising at least one cellulase and at least one pectinase, 50 mM to 750 mM a salt, and a buffer or buffer system that maintains the pH in the range of 5 to 6.6, at room temperature to produce a digested fraction; (c) filtration of the digested fraction to produce a filtered fraction and recovery of plant-derived proteins, or superstructure proteins, from the filtered fraction, in which the superstructure proteins have a molecular weight of 75 to 1500 kDa.
[0013]
13. Method according to claim 12, characterized by the fact that in the production stage (stage a), the plant is cultivated and the plant material or plant is collected.
[0014]
Method according to claim 12, characterized in that the mixture of enzymes that degrade the cell wall further comprises an osmotic.
[0015]
Method according to claim 12, characterized in that the mixture of enzymes that degrades the cell wall consists of at least one cellulase and at least one pectinase.
[0016]
16. Method according to claim 12, characterized by the fact that in the obtaining step (step a), plant or plant material is transformed with a nucleic acid that comprises a sequence of nucleotides that encodes proteins, or suprastructure proteins, is selected from a group of a peptide, a protein, a protein rosette, a protein complex, a proteasome, a metabolon, a transcription complex, a recombination complex, a photosynthetic complex, a membrane transport complex, a complex nuclear pore, a protein nanoparticle, a glycoprotein, an antibody, a polyclonal antibody, a monoclonal antibody, a single chain monoclonal antibody, a virus-like particle, a viral envelope protein, a viral structural protein, a capsid protein viral, a viral wrap protein, a chimeric protein, a chimeric protein complex, a chimeric protein nanoparticle, a chimeric glycoprotein, a chimeric antibody, chimeric monoclonal antibody, chimeric single chain monoclonal antibody, chimeric hemagglutinin, and plant or plant material are collected.
[0017]
17. Method according to claim 16, characterized in that the nucleic acid is introduced into the plant or plant matter in a transient manner.
[0018]
18. Method according to claim 16, characterized in that the nucleic acid is stably integrated into the genome of the plant or plant material.
[0019]
19. Method according to claim 16, characterized in that the plant-derived proteins, or suprastructure proteins, comprise a monoclonal antibody or an influenza hemagglutinin.
[0020]
20. Method according to claim 12, characterized by the fact that it also comprises a step of (d) separating the proteins or suprastructure proteins, in the filtered fraction of the cellular fragments and insoluble materials.
[0021]
21. Method according to claim 20, characterized by the fact that the separation step is carried out by centrifugation.
[0022]
22. Method according to claim 20, characterized by the fact that the separation step is carried out by deep filtration.
[0023]
23. Method according to claim 12, characterized by the fact that it further comprises the step of (d) purifying proteins derived from the plant or suprastructure proteins, from the filtered fraction.
[0024]
24. Method according to claim 23, characterized by the fact that the purification step comprises the depth filtration of the filtered fraction to produce a clarified extract, followed by chromatography of the clarified extract using a cation exchange resin, a resin by exclusion in size, an affinity resin, or a combination of them.
[0025]
25. Method according to claim 1, characterized by the fact that the salt comprises Ca2 +, Mg2 +, Na +, K +, NaCI, CaCh, CUSO4 or KNO3.
[0026]
26. Method according to claim 12, characterized in that the salt comprises Ca2 +, Mg2 +, Na +, K +, NaCI, CaCh, CuSθ4 or KNO3.
[0027]
27. Method according to claim 1, characterized in that the mixture of enzymes that degrade the cell wall further comprises 5 mM to 200 mM EDTA or EGTA.
[0028]
28. Method according to claim 12, characterized in that the mixture of enzymes that degrade the cell wall further comprises 5 mM to 200 mM EDTA or EGTA.
[0029]
29. Method according to claim 1, characterized in that the mixture of enzymes that degrade the cell wall further comprises 125 mM citrate or less.
[0030]
30. Method according to claim 12, characterized in that the mixture of enzymes that degrade the cell wall further comprises 125 mM citrate or less.
[0031]
31. Method according to claim 1, characterized by the fact that the production step (step b) is conducted at a temperature of 18 ° C to 24 ° C.
[0032]
32. Method according to claim 12, characterized by the fact that the production step (step b) is conducted at a temperature of 18 ° C to 24 ° C.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112012006414B1|2020-09-15|METHODS FOR THE PREPARATION OF PROTEINS DERIVED FROM PLANTS

---

AU2017202473B2|2018-12-20|Method of recovering plant-derived proteins

---

CA2850407A1|2013-04-04|Increasing virus-like particle yield in plants

---

CA2831000C|2022-02-22|Method of recovering plant-derived proteins

同族专利:

---

公开号 | 公开日

---

CN107129973A|2017-09-05|

---

PL2480658T3|2017-12-29|

---

MX2012003372A|2012-05-29|

---

KR20120093223A|2012-08-22|

---

RU2012115996A|2013-10-27|

---

AU2010300033A1|2012-03-22|

---

SG178947A1|2012-04-27|

---

CN102549008A|2012-07-04|

---

JP2013505272A|2013-02-14|

---

CA2772962A1|2011-03-31|

---

CA2772964C|2020-10-27|

---

HRP20171564T1|2017-11-17|

---

CA2772964A1|2011-03-31|

---

NZ598481A|2014-02-28|

---

EP2480560A1|2012-08-01|

---

KR102115226B1|2020-05-27|

---

TR201803560T4|2019-01-21|

---

CN107090021A|2017-08-25|

---

EP2480658A1|2012-08-01|

---

EP2480658A4|2013-02-27|

---

ZA201202835B|2015-08-26|

---

JP5551780B2|2014-07-16|

---

EP2480560A4|2013-01-23|

---

CA2772962C|2013-04-02|

---

KR101773431B1|2017-09-12|

---

JP2013505025A|2013-02-14|

---

PT2480658T|2017-11-13|

---

IL218422D0|2012-04-30|

---

IL270661A|2021-12-01|

---

IL218393D0|2012-04-30|

---

PL2480560T3|2018-06-29|

---

CN102549148A|2012-07-04|

---

AU2010300034A1|2012-03-22|

---

US20120178149A1|2012-07-12|

---

SI2480658T1|2017-11-30|

---

KR20190050862A|2019-05-13|

---

IN2012DN02637A|2015-09-04|

---

HUE036776T2|2018-07-30|

---

IL257261D0|2018-03-29|

---

BR112012006415B1|2020-04-28|

---

SI2480560T1|2018-04-30|

---

HRP20180509T1|2018-05-04|

---

KR20120072371A|2012-07-03|

---

AR078433A1|2011-11-09|

---

EP3354657A1|2018-08-01|

---

EP2480560B1|2018-02-21|

---

NO2480658T3|2018-02-03|

---

NZ598508A|2014-02-28|

---

KR20180026562A|2018-03-12|

---

WO2011035423A1|2011-03-31|

---

BR112012006414A2|2016-11-16|

---

JP5554414B2|2014-07-23|

---

AU2010300033B2|2015-01-22|

---

NO2480560T3|2018-07-21|

---

ES2642631T3|2017-11-17|

---

RU2012115661A|2013-10-27|

---

AU2010300034B2|2015-07-30|

---

PT2480560T|2018-04-03|

---

RU2579903C2|2016-04-10|

---

WO2011035422A1|2011-03-31|

---

RU2567012C2|2015-10-27|

---

DK2480560T3|2018-04-16|

---

EP2480658B1|2017-09-06|

---

MX2012003373A|2012-05-29|

---

SG178918A1|2012-04-27|

---

BR112012006415A2|2016-11-16|

---

IL257261A|2020-03-31|

---

MY158475A|2016-10-14|

---

DK2480658T3|2017-11-06|

---

MY164704A|2018-01-30|

---

EP3354657B1|2022-01-26|

---

ZA201202836B|2012-12-27|

---

AR078432A1|2011-11-09|

---

IN2012DN02591A|2015-08-28|

---

BR112012006414A8|2017-10-10|

---

ES2662778T3|2018-04-09|

---

IL218422A|2018-03-29|

---

HUE038557T2|2018-10-29|

---

US20130067807A1|2013-03-21|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US5100792A|1984-11-13|1992-03-31|Cornell Research Foundation, Inc.|Method for transporting substances into living cells and tissues|

---

US4945050A|1984-11-13|1990-07-31|Cornell Research Foundation, Inc.|Method for transporting substances into living cells and tissues and apparatus therefor|

---

US5036006A|1984-11-13|1991-07-30|Cornell Research Foundation, Inc.|Method for transporting substances into living cells and tissues and apparatus therefor|

---

US5232833A|1988-09-14|1993-08-03|Stressgen Biotechnologies Corporation|Accumulation of heat shock proteins for evaluating biological damage due to chronic exposure of an organism to sublethal levels of pollutants|

---

US6403865B1|1990-08-24|2002-06-11|Syngenta Investment Corp.|Method of producing transgenic maize using direct transformation of commercially important genotypes|

---

US5625136A|1991-10-04|1997-04-29|Ciba-Geigy Corporation|Synthetic DNA sequence having enhanced insecticidal activity in maize|

---

US6326470B1|1997-04-15|2001-12-04|The Penn State Research Foundation|Enhancement of accessibility of cellulose by expansins|

---

WO1997004122A1|1995-07-20|1997-02-06|Washington State University Research Foundation|Production of secreted foreign polypeptides in plant cell culture|

---

MXPA01001445A|1998-08-11|2002-11-29|Large Scale Biology Corp|Method for recovering proteins from the interstitial fluid of plant tissues.|

---

CA2352488A1|1998-12-23|2000-06-29|The Samuel Roberts Noble Foundation, Inc.|Plant transformation process|

---

AU4365200A|1999-04-21|2000-11-02|Samuel Roberts Noble Foundation, Inc., The|Plant transformation process|

---

US20040009193A1|2000-08-08|2004-01-15|Yuko Morikawa|Virus-like micrograins and process for producing the same|

---

EP1434800B1|2001-09-14|2010-12-01|Fraunhofer-Gesellschaft zur Förderung der angewandten Forschung e.V.|Immunoglobulin having particular framework scaffold and methods of making and using|

---

AT473271T|2003-05-05|2010-07-15|Thompson Boyce Plant Res|VECTORS AND CELLS FOR THE MANUFACTURE OF IMMUNOPROTEKTIVE COMPOSITIONS DERIVED FROM TRANSGENIC PLANTS|

---

CN1560227A|2004-02-25|2005-01-05|福建师范大学|Preparation and regenerating technology for protoplasm of rainy red ball alga|

---

EA013540B1|2005-03-15|2010-06-30|Верениум Корпорейшн|Cellulases, nucleic acids encoding them and methods for making and using them|

---

EP2374892B1|2005-04-29|2018-02-14|University of Cape Town|Expression of viral proteins in plants|

---

MX2008000097A|2005-06-24|2008-03-19|Bayer Bioscience Nv|Methods for altering the reactivity of plant cell walls.|

---

CA2630220C|2005-11-22|2020-10-13|Doris Coit|Norovirus and sapovirus antigens|

---

CA2651907C|2006-05-22|2016-12-20|Plant Bioscience Limited|Bipartite system, method and composition for the constitutive and inducible expression of high levels of foreign proteins in plants|

---

EP2155880B1|2007-06-15|2016-08-10|Medicago Inc.|Modifying glycoprotein production in plants|

---

KR20100120157A|2007-11-27|2010-11-12|메디카고 인코포레이티드|Recombinant influenza virus-like particles produced in transgenic plants expressing hemagglutinin|

---

KR101956910B1|2008-01-21|2019-03-12|메디카고 인코포레이티드|RECOMBINANT INFLUENZA VIRUS-LIKE PARTICLES PRODUCED IN TRANSGENIC PLANTS EXPRESSING HEMAGGLUTININ|

---

CA2615372A1|2007-07-13|2009-01-13|Marc-Andre D'aoust|Influenza virus-like particles comprising hemagglutinin|

---

RU2358981C2|2007-08-07|2009-06-20|Центр "Биоинженерия" Российской Академии Наук|Universal avian influenza virus vaccine|

---

CN101422128B|2007-10-29|2011-06-08|中国水产科学研究院黄海水产研究所|Separation and regeneration method of gulfweed protoplast|

---

EA201001064A1|2007-12-28|2011-02-28|Юнилевер Н.В.|METHOD OF EXTRACTING AROMA FROM TEA|

---

CN101626276A|2008-07-10|2010-01-13|华为技术有限公司|Method, device and system for replacing advertisement|

---

WO2010042551A2|2008-10-06|2010-04-15|Genvault Corporation|Methods for providing cellular lysates from cell wall-containing samples|

---

ES2642631T3|2009-09-22|2017-11-17|Medicago Inc.|Method of preparation of plant-derived VLP|KR20100120157A|2007-11-27|2010-11-12|메디카고 인코포레이티드|Recombinant influenza virus-like particles produced in transgenic plants expressing hemagglutinin|

---

CA2615372A1|2007-07-13|2009-01-13|Marc-Andre D'aoust|Influenza virus-like particlescomprising hemagglutinin|

---

KR101377725B1|2009-06-24|2014-03-27|메디카고 인코포레이티드|Chimeric influenza virus-like particles comprising hemagglutinin|

---

ES2642631T3|2009-09-22|2017-11-17|Medicago Inc.|Method of preparation of plant-derived VLP|

---

TWI526539B|2010-12-22|2016-03-21|苜蓿股份有限公司|Method of producing virus-like particlesin plants and vlp produced by such method|

---

TWI620816B|2011-03-23|2018-04-11|苜蓿股份有限公司|Method of recovering plant-derived proteins|

---

CA2839009C|2011-06-13|2015-10-20|Medicago Inc.|Rabies virus like particle production in plants|

---

EP2758038B1|2011-09-23|2018-05-30|The United States of America, as represented by The Secretary, Department of Health & Human Services|Novel influenza hemagglutinin protein-based vaccines|

---

KR101974017B1|2011-09-30|2019-04-30|메디카고 인코포레이티드|Increasing virus-like particle yield in plants|

---

AR089440A1|2011-12-21|2014-08-20|Apse Llc|PROCESSES USING VIRUS SIMILAR PARTICLESWITH HYDROLASSES RESISTANT CAPSIDES|

---

JP6406655B2|2012-02-22|2018-10-17|三菱商事フードテック株式会社|Method for softening vegetable food material, softened preparation, softened vegetable food material and food using the same|

---

IN2014DN07152A|2012-03-22|2015-04-24|Fraunhofer Usa Inc|

---

SG10201810400TA|2012-09-05|2018-12-28|Medicago Inc|Picornavirus-like particle production in plants|

---

US9617297B2|2012-10-11|2017-04-11|The Regents Of The University Of California|Apoplast wash fluid recovery for improved recombinant endoglucanase extraction in tabacco leaves|

---

CA2907591A1|2013-03-28|2014-10-02|Medicago Inc.|Influenza virus-like particle production in plants|

---

JP6358257B2|2013-09-06|2018-07-18|三菱ケミカル株式会社|Protein production method using plants|

---

WO2015054639A1|2013-10-11|2015-04-16|The United States Of America, As Represented By The Secretary, Department Of Health And Human Services|Epstein-barr virus vaccines|

---

WO2016004536A1|2014-07-11|2016-01-14|Medicago Inc.|Modifying protein production in plants|

---

AU2015373928B2|2014-12-31|2019-10-17|The Usa, As Represented By The Secretary, Dept. Of Health And Human Services|Novel multivalent nanoparticle-based vaccines|

---

JP2019129705A|2016-03-31|2019-08-08|日本たばこ産業株式会社|Method for introducing substance into plant|

---

EP3717648A4|2017-11-30|2021-12-01|Medicago Inc.|Modified norovirus vp1 proteins and vlps comprising modified norovirus vp1 proteins|

---

WO2020010428A1|2018-07-13|2020-01-16|Medicago Inc.|Modified norovirus vp1 proteins and vlps comprising modified norovirus vp1 proteins|

---

CN109112093B|2018-09-05|2021-11-09|上海交通大学|Method for efficient separation and instantaneous transformation of artemisia apiacea protoplast|

---

CN110483616B|2019-07-31|2021-06-04|中国农业科学院农产品加工研究所|Method for separating apoplast effector protein secreted by pathogenic bacteria from plant tissue infected by pathogenic bacteria|

---

CN111718394A|2020-06-28|2020-09-29|广西壮族自治区农业科学院|Method for extracting sugarcane tissue denatured protein based on BPP method|

法律状态:
2019-07-16| B07A| Application suspended after technical examination (opinion) [chapter 7.1 patent gazette]|

---

2020-04-28| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2020-09-15| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 21/09/2010, OBSERVADAS AS CONDICOES LEGAIS. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US24478609P| true| 2009-09-22|2009-09-22|

---

US61/244,786|2009-09-22|

---

PCT/CA2010/001489|WO2011035423A1|2009-09-22|2010-09-21|Method of preparing plant-derived proteins|

---